Description :
From Genome Similarity Track
Location :
Scaffold_449:7453- 9395
Sequence
1942 bases(100 bases per row)
CCTGCATGCGATCACCCCTAGTGGTTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCG
TTAATCATCTCTGTGTACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTAACTTACATTCAGGAAGACTTCAGAGCACCC
ATGAACAACTCCCGTAGCCACCGTACTTCTCTGGCTTCGCTGATCCGTCAAAAGACATGACTAATCCGCTGTAATTACGGGGAAGCCTGGCGTACAGCAA
CGCGGGGTTCATTCGAATAGTCGGAGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGTGAGTCTTCCAAGTCGATGAAGCTCATGATGCTTGACTACAGG
AGCTGTGCGAAGGCGACATCTTTCTCCTTCACGCGCTGCACCTTCAAATGCCACTGCGAAAGCAGTACGGCGAACTGGACCGCGCGTCCGAAGAGAGACT
TCGACTTGTGCACCCACTCTAACCTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGC
CAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCGTCATGTTCTTGCATT
AGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCT
TCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTC
GTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTG
GGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTCGGTGAAGCTAATGCTGATCCGACACT
GTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATAC
AGGTACCAGCGATGATTCGTCTGGCTCCCCGTTTGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCG
CGGTCTGCCGCGAACTTCGTTTGAAACGAATTCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGCATTCAA
ACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCAAAGGGCATGCGTAACCA
CTCAAAATGTCCTAGTGCGCAGACGAACGCTGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAAC
CATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGA
TCCGGATGTCCAGCCCGTTCTTTTTATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACTATCAGTCCTGCACGCAATAAAGCGCGCAGC
AGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCTCCGTAGG
CTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCT