Description :
From Genome Similarity Track
Location :
Scaffold_612:7450- 10245
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_612-snap-gene-0.73-hydroxy-3-methylglutaryl-coenzyme A reductase
Pytiw_DAOMBR242034snap_masked-piw_contig_612-abinit-gene-0.11Ubiquitin-protein ligase

Sequence
2795 bases(100 bases per row)
CGCGTACGGCGCTGCATGCACAAGTTTGTGAGGATGCGAAGTCCGCATCGGCTCTTTGTGATCCGACAGACTTCATCCGAGAGGCCTTCTGCGACAGTGT
TGACAATGTTGGCACCCATAGCCTCGCACACATCGACATCGATGTGGACGACGAGGTACTGGACGCTCGATGCGGACGCCTGGATCACGACCTCGTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGGCACGTACCA
GTGCTTCGCCTCGTCCCTGTGCGAGAACTTGGAACGCGACGCCTCGCTCACGATCCGGCAGTAGATGTCAAGCGCGCCGCCACCGCGCTTCTTCATATTT
GGGCACAGCGTCGTGTTTGCGATCGCTAGGAGGCGTTCACGGTGGACAGCGATGGTCTTAACCGCAGCTTCGAGGTCGGGCGTGTCGACGAGCTGGATCT
GCGACGTCATGATGTTGCCAGACGTGGCCGTGCGGAAGCCTCCGCCGAACGAGGCCACGAGCTTCGCGGCGCTGGACGCCGCAGCCACCACGGACGGCTC
TTCCACTGCCATGGGCACGGACAGGCTCTTGCCGTCAATCACAAAGTTGAGTCCCAGTCTGCACAGCAACCACGGCACACACAGTTAAGCTCGCCTCTCA
ATAAAACAATCCACACACACACACAGAAAGAGACTCACCCGAGCGGAATGCCAATGACGCCAATGCAGTTCTCGATCATGAGATTCGCTGTGCGCAGCGG
CAGCTCGCCCAGCTTGGCGACGGGGTCGGCCGACTCGATGGGCGCCTCGTGGTTCGCGTCGCTCTGCTTGACGCGACCGATGCGCGGATACATGAGTGAG
AGCACGTCGAAGCGCTCGCGCAGCGTCTTGTTGTAGAAGCCCGACCAAATCGACGGCTGCAACGAGTTCGCGGGCGCGGCCGTCTTGGTGGTGGACGACG
CCGCCCACGACTCGCTGTCATGCGCGCTCGGCTGCAGCGGGTCGAACTTCTTGCGCTCCACGAGATCACTGCTGTTGCTGGTGCTGACATTGCAATCGCT
CTGCTGGCCGGTGTGTAGCAGACACGCCCTGATCTCGCCAGCAATCGCGCTGATCTCCTCGACCTTGCTCATCACATTCGCATGTTGCTCGTTGTTCGTC
ACGCCCACTGGGCTCTGCCGCGCAGCCTTCAGCAGTGAGCGGACGTGGAGCAGCGCGTCTTCCAGCGCATTCTGGAACTCGCATGTGTTCGTTGCAGTAG
CGTCGCTCCAGCCATTCGCGTTGCCATTGCGCAGCTCCACGCGTGAGACCATCGCTGTCGTCATAGCTCAAGTGTTTCTCTCTCGCGTCTCGGATTCAGC
AATGAGCGTTCGTTGGTCTGCCAGACCAGGATGCAACGGTGCGACTCGCTGCTGCTTGGAGCTCAATGACAACGACGAATGGCGCGTTCTTTCTACGCTT
TGGCCGTTCCTGCGCCGCTCGTGGGGGCTGCTGCGGTCGTTCTGCGCTGCTGCCTCGCCACTGGATCTCTCTTGTCTCTCTATGGGATGCGAGTGGAGAA
CGCAGTGGCAAGTGGCACTGGAAGGAGCTGCTGGAAGGAGCTGCTGGTGATGGATGCGGGCGGAAGTTTCGCGTGTGGCCTCACGTCAACATTCACAGAC
CGTCACTCCTCTTTTTCATTTGCGCCAAAAATACGAACGCGACGAACGGTTCAGAGTGAGTGGGCGGATTGAGGCAGCACACTAAATACAGTGCTTTTTA
ATTTTATCTTGTCTATAAAAGTCTGTTCAAATGGACAGAAAACAACTAATATGTTCATGTTTATGCTTCAATATTGATCAAATATCACTGTGAATATCTT
AGTTTGCAAAGTATGCTTGAAAGTTCCTTCTGTCTGGGGGTGCATTTTGCAGTGATTTCTGAAGTTGTGTGCCCTTGTGTTCATTATCGAAATGCACCCA
GGCACTCAGGCCGTGAAAACAGCTTGGTGACGGCAGCAGCTTGATGATGGGAGGTTCCATCTGTGAATACGCCCCGCCACCCATCAACATCCAACATTGC
GAGCTGTCGTCACCAGCACAATCCCAGGTGCGTGGGCCACATTGGCCAAAACTGGGTACAGTACGCAGCGTTTCAGCATACATGGCTACATTTTAAGATA
GATGTCAGTCTTTGCGAGAAAAAGGTCCGACCTCAAACACCATCAACCTTCATTTACCTTAATGGATGGTTGGTTAGTCCAGCAGCTCCTCTTCGTCCTC
CCACTCGTTCTCTCCGTACGACTCCTCTGCTGCTGCATCGTTCCGCCGTGCTGACTTCTTGGGGCTCTTCGATGGAGAAGTTTCGGATCCAGCGACCGTT
TCTGCATCCACTGCTGTGGTTGAAGCTGGTTCGTCAGGATCCCCAGCAGCTTCATCATCAACCGACTCCTTTCGAACGGTGAGCTCTTCCTGGAGTCCCG
GAGACAGTGACGACGTCGACTCACCAGTCTGCACACGAACGGTGTCTCTGGCGCTACTCTCGCCCTCGTCTGCCATGCCTGGGATGTCGAGCGACTCGTA
GCTTTCTTCTCCCTTGCTCGTCGAGCTTCCTGGTCGTTTCTCAGACTTCTCCAAGAGAATGCCGGCAATCGCGCTCGTTGCATCCAGACCGTACC