Description :
From Genome Similarity Track
Location :
scaffold_174:745- 2753
Transcript NameFunction/comments
Pl_108273hypothetical protein PHYSODRAFT_548135

Sequence
2008 bases(100 bases per row)
CGGACGACATGCTCCTCGTAGCACTCAATGAGCAGTGGGTAGACCACCAGGTCGTCATGACCATGGTGCGCGACATCCTCATGTACATGGATCGCACCTA
CGTCACTCAGAAGCGCAAGCTCCCAGTGTACGATAATGGACTTTATATCTTCCGGGACGTCATTGTGCGTCACGACAGTGTGCGTGACCGTCTACGTGCT
CGTCTTCTCCTCAATATCGAGCGAGAACGACATGGAGAACTCATTGACAGAGATCTGCTCAAGAGTGTACTACGTATGCTCGTGGATCTTGGTGTACACT
CGAATACAGTGTACGAGAATGACTTTGAGAAGTTTTTCCTCGATACGACATTGGACTTTTACCGTGCGGAAGCGCAAGCTATGCTGGATGTGGCCACGTG
TTCAGAGTACTTGGAGAAGGCAGAACAACGACTGAATGAAGAAGGAGCTCGAGTATTGCACTATCTCAACCCGTCTACGGAACACAAACTCAAAACAATT
GTCGAGACACAGTTGATTAAGAATCAGGCCAAAGCATTGGTGGATATGGAGCATTCAGGTTGTGTCGTGCTGTTCCGTGATGGCAAAACGCAGGCGTTAC
GCAGGATGTACTCACTCTTTCGTCGTGTACCAAGTACTCTGCCTGAAATCAGTGAGTGCGTGTTCCAGTATATTAAAACGACTGGAGACGAGATTGTGAA
GACGCAATCAAATATGGAGACATCACTGGATACCTCGCAGTTCGTGGAAAAGCTATTGACGTTGCGCGAAAAATTTGTGGGTTTCCTGTCGGATTGCTTT
TTTGACGATCCGCAGTTCCACAAATCCATCAAACAAGGCTTTGAAGCCTTCATGAATACAAACACAGTGTGTGCTGGATACCTGGCACATTATCTTGACG
AGTTGCTGCGCTCGAAGAACCGGTTTGAAGAGGAAATGGATACCCGCGTAACGCAAGTCATCGCTCTGTTTCGGTATCTTCAGGACAAAGACGTGTTTGA
GGAGTTCTACAAGGTATTGCTCGCCAAACGTCTTCTTAACAGCCGCGGTACCTCGGACGAGTCGGAAAAACTAGTGATTTCGAAGCTCAAGGCGGAGTGT
GGTTACCAGTTCACCTCCAAGCTCGAGGGTATGTTTAAGGATATGAGTATTTCGAAGGACCTTATGGAGCTGTATCGGAAATCGGGTTTCGACACTAGAG
GTAGCGGTTTTGGTATCGATATGTCTGTCGCACCCATGCCGCTGTCGGTGCATGTTCTCACAAGTGGTTTCTGGCCCACCGAGATGGCTCCCATGTGCTC
TCTACCTTTGGAACTTGTTCAGCTGACACAGACATTCGAGTCGTTCTATTACGCACGGCACAATGGTCGCAAGCTGGCGTGGATGGCAAATATGGGTACG
GTGGATGTTCGTGCCACATTTTCAGCAGGCGTGGAGGACGGTAAACGTCGTCACGAGTTGAATGTGTCGACGTATCAAGCTGTCATTCTGATGTTGTTCA
ACCAGCGCTCAGAGTGGCATTTCAAGGATCTCGTCGAGCGAACGGGTATTGACGTTAAGGATCTAAAGCGACACCTTATCTCTCTCTGCACGCCAAAGTA
CAAGATTTTGATCAAGAGCTCGAAGGGAAAGCGTATCGATGAGGAATCTGATGCTTTTACAGTGAACGACGCGTACAAGTCGAAGTTGCATCGTGTACGG
ATACCACTGGTGTCACAAAAGGAGACATCGTTGCTGCCTGTCGTCGCATCAAGCACAACCTCAGCCGACGCACTACCACCTACAGTCGCTGAAGACCGGA
AGCACCTTGTCGAGGCTTCGATCGTGCGTATCATGAAGACTCGCAAGCAAATGCAACACAATCAACTCATCGCCGAAGTGACTCGTCAGATGGCAGGTCG
CTTCACGCCGTCTCCACAGCTCATCAAACTGCGGATTGAAAGTCTTATCGAGCGAGAATATCTCCAACGCAGCACAACAGACCGACGAATGTACAACTAT
TTAGCTTA