Description :
From Genome Similarity Track
Location :
Scaffold_670:7449- 10823
Sequence
3374 bases(100 bases per row)
CCACACATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTTATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTC
TGATCCAAATCCTGGACATATATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGATTGGGGACGATATGCCATGGTTGCTC
GCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTTTAATCATTTCGCTAGCTCCAAATCTTCG
GAGAACACACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGATGCACTAGCCTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAAC
AATTCTGTGTTCCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCC
CTTCGATTGTGGGTCTGCCCTTGCCTGTCTCACAATCCACACATTCACCGACATATCGCTGTACGCTCTTGAATAGTCCTCTCCAGTGAAAACATTCCGG
ATCCGTTGGTAGGTCCGACCGATGCCCTGATGTCCACCTTCTAAACTAGCGTGGTAGTGGTGTAGGACATCCTGTTGTAAGGTCTCTGGCATCACCAATC
TCATCAATCCATCTCGATCCTCGTGGACTCTCTTCGTAGGGGGGGGGGCAATAGAAAAGCAAGTCATTCAGATCCACTGCGTCATTCGTAGCGATAATGC
TGTAGGATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCTTTAATCCCAGGATCCACGCTTCCTCGTTCAGTGCTTTGAGGAT
CCGCTCAATGCGGACTCTCTTCACAAATATTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTC
CTTTTCCCGGATCCGACTACCACCACTTCGTCTAGTCGATTCAACGTAGCGAGATCTTGATGCTCGGCCTCTCTCTCCACTTCAACGCCGCATTGATTCC
GTAAAGCGGCACTGGCCAAGCTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGAGGATCATCACTTT
CTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATGCCCACAAATCACCAGCCGTTTTGGA
TTATGTTTCTTTAGTAAATCCAAACCCAGAAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTT
CCCATCCAGGTAGTCTCCACAGTATTGCACTGTATGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCAC
TCGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGTTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTC
GCGGCGAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCTAGTGTCCAGAGCGAGAGCAAAGCTGCCCACTTTCCCAAACGTCCTT
GTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATTTTTTCACTAGCAGGTTGTAATTCAGATCCAACACGCG
CAGGAGCGCGAGTACCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGT
TCTTGTACCAAGGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATAACCGTAGGTTGACGTTCCGGATCGAAATGAAGAGGATGGGTGTGGTCGCGAT
CTTGTTCCTCAGCTCCACAAATGCGTGTTGAGCTCGGATCCACCGAGGTTCCACCCTTTCCGAGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCT
CTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAG
CTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGAT
GACCCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTTACGACTGTGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTC
GCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATTCCCCAATAGATCTTTACCACACTGATAGAGAGATTCCACTTAGTAC
ACGCCTCCAGTAGGGATGTCACGCTTTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGG
GGTCCCAGGATCCTCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCCTTTTCGGGATCCGGTATTCGGGTGAATCCA
TAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATG
CGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGACCTTCCAACAG
CTTATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCCTTAGCCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATG
ATGATTACCACCGGAGATGCCCACGGGGACGTTAAGAAGCTGATAATCTTGGCTTGCAGCAGGCCCTTAATCAGATTCGATAGTTTTTCTCGGAACTGAG
GTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACAGATGACTCCGCGGCCAATCAGCAGATGTCAGCTTTCCCAGAT
CTTCTGACGTAACCGATTCACTTCCGCGGGTTCGTTCGCCCCTGGATCCACTTGGATGTCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGG
ATCACTGTCAGACCTTCTCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTATTAGACTTGTTCATCTTC