Description :
From Genome Similarity Track
Location :
Scaffold_1086:7449- 9300
Transcript NameFunction/comments
Phyta_totarag11990transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
1851 bases(100 bases per row)
TAGAGCCTCATTTTGGTCCACGAGGatgtcgagcagctcctgcgtctGATTCTGCTCCGTTTTCTCTGAttccagcacgtccagactggccacttcgtcg
tcgtcacttgcAGCCAATAGACACGGATCGCTACTGCCTGGAACAGCTCGGCGCGGCTCGAACCCgaggctggagctgcgtgGCAACAATAAAAACTTTG
AATTATCGGATTTTTTACGGATGTTTTGTGCGGTTTTAGGGCTTTTCGGCGCGAgttcgtcatcgctgtcactgctgctgctgatgatCTGCTCCTGTAG
CCCTGGCAAGGAAGAGCCCGTGGGTCGCAGCTCGGTGGAggctgcggtggcggcgTGAGAAGCCTCCATGCAGAGCCTAGAGGACGAGACTCGTGCAACC
TGGTAGAGAGTGCAACCTGGTAAAGAGTGAAAAGTGACCGGATGACTGGAACTTTTGCTTTTATCTTAGCGGATATAGTGGGTGCAGAAAACGGGGGATA
AGAGGTTGATTTTTTGAGCGGGaagtttgaatttgaatAAAACAAATTCGCGGGAAGGTGAAAGTTGATGAGATCGGATAAATTTTGATGATACAAGGAA
GACGTAAAGTTATTATATTACTGTCAAGCTTCACTAATGGATGGTAGGCTGGCCTTATTTTTCACGCGGATAAAAAGTAGTTGGCGACTTTCAAATGCGC
CTCCCAATCTTCGATCACAGAATTTCACAATGCCCGTGCAAGGACGTTCACTACATGGTTCAACACGCTGACTTGAAATAGCTCCGATCACGAACAAGTC
ATCCCTCAAGACCCTAAACCAACGGATTTTGCGTAGGACAAGATAATCAGAGCCATCTTCCTCAGTCATCCATAATAGTCCAAATGATTTTAGCGCACTA
GCAGTGTAATACAATTTGTCACCGTCCCATCGATAGCCTCCCAGCAGGAACATTTTGTTTCTCAGTTTTAAACTGGTGTCAACACAACACGGCGCTGTTA
AAATGGCCCATGTGCGGTGATTCAGCCAGACATAACCAATCGCCCACAGTGCTCGAACGGATATCACAAGCGCTACGATGgccagcacgaagacgccgtg
GCCAACTAAACTCCAGGCATAATAAGATACCGCTAGCGCAGTTGACCTTGTTTCTTTCAGCTTGGATCGGTTCAAGAGTGTGAGGGAGTACTGCTGAAGT
GCAGCAGTACAAACTTCGCCTACGAACGCGGTCTCATAGCTGAACAATAGTCGCTTAATTCGGACCCGCCATTTTTCTCTCAAACAGATCGTGCTCTCGA
TAATCTCGAAGACCATCACAAGCAGTGCAGACATGTTATAACCCATTGAAACGTACTGCACCTTTGCCAAAAATCCATCGTTTGCGATGAGAAGAAACAA
GTCCGTCATGATGCTTTCAACCAGCAAATACAACACCATCGCTCGATGAAAATTGGTCGCACCATGTGCCGCAAGCCGCAGATTTTCTTGAACAAATACC
ATTGCTTCTTTTTGGTTAAGCCTTTCATCCATTCCATCGCACATTCGACCATGCCGCTTACACGAGATGTAGCTTCGCCGCAACACGAGCGCTCGATACA
CCAGCCAAACCGCTCCCCCAATGCTGTACCAGTATGACTGCCTGTAGTTCTCACTTCCTGTGTCTTTAGCCAACACAGGTCCGTTGATATCAAAAGTGCC
CAGACCCTGGCCAACAATGTACGCGATATTATCATTAGCGCAGTAGCTGCCGGTTTGTTCTTCATAAAAGGAGTAAAATCCGATGCTGCCGTGGTAAAAA
TACTGAGAGTAAGCGAAGCTGTCGTTTGCACAACTGGTTGGCGTTGTGTAG