Description :
From Genome Similarity Track
Location :
scaffold_515:7448- 10388
Transcript NameFunction/comments
g8914.t1 4-coumarate-CoA ligase, putative

Sequence
2940 bases(100 bases per row)
GCGGCGTAACGGTTTGCCCGACGTATTTTGGGGGATCGTCTCGATAAACTGGACCTCGCGGATCGTCTTGTACGCCGCGACCTGCCGATGACATTTTGAT
GTCAAAGGTCTTATGATAAGACCTTTGACTCTCATCGAGTTCAGAATCCCGAATTCCGATGCAGACCAGCGCCGAATTGAGTTGAAGCTGCGACGCCAGC
ATAACGTGCGCTCCCCTTCAACGCATTTCGCCACGCGGGGTGACAGTGGTTGTAACGCTAGATTGCCAATGCCGTCGAGTGGTTTCAAGTCCACTTCTCC
TCAGTGTTCCAGTGGGGGGCCACCGAGACCTTCGAAGTTCGCTGTTATTGACACTGTCAGCGGGTGCCATCGGAATTGACGTTGAAATGGACAAGTCTCT
AAAAACGAGATAAATTAAAAATGCCATGTCTTTCGAGCTTACACGTAGTAGAGATCAGGTCGAGGCGCGATATTCACCTTGCAGTTATGCAGCAGTCTCG
GTAGTCGATAGACACCCGTGCTCCCTTCCGTCGCGTCGCCGCTGTATTGATATTCACCAGCCAGAAAGACTCGGTAGACGAATGCCGGTACAGCTAACGA
CACATCCAGGCCACCCAGTTTCTCCAGCCGGAACTGTGCATCCTGAGTCAGCGGCTGTCGGACTTTCAGCACGAGGTCGTCATCTGGTCTATCACTACAC
ATTCCGATAGCTGGAGCAACTTTTCCACCCCCTTCGGAAGACGACGGACTCGACAGCTCTTCCTCGATCGAGTGCGGCACCCAGCGCGTGGATCTTGTCT
CGTTCACCTTGTCCATTGCCTGTTGCTCTTCCACTCCACTGCAGTCGCTGGACCTGGCGCTGCCCAAGTCCAGAGTCGCGCAGTCTTCCTCCACGTTGCT
TGCCTGTCTGGTTTCCGCTTGCTTCAGACTTTGTCGCCGCATCCGCACGTGCATCTGCGCCTCGAAGACGTTCTTGACGGCCTTTTCGCGCTCCTGTTGT
CGCCATTGGCGTCGTCTCTTGATCATCGTCTTGGGCACCAGGAAGGCGAATGCCTCCCGTTGCTGGATGTAACTGTGCGCCGCCAGTTTTGCCACGTTAT
TGGAAAAGAAACGTAGCAACAAGGCTGCCCTTTTGGTTTTGCATTCTCTAAAGAGCTCCCCACCTAAACGGCGTATAGTCGTGCCACCTGCTGGCAAGCT
CGCCGGTACGGTAAGGTGCCGAGTTGCCGGCAAATTTGAGCAGAAAGAAATCTTTGCGGAAACCTGCACTTCAACACAGTCTGGTTGGCTCGCGAAAAAG
CTACTTTTACTGTACCGCAGAAATTCAGTGTACACCGGATATTATCCTGGGATTTCCCTCCTATCATGAGCAAAGAAAAAACATTTGTGTTTATCACACA
TACTCCGATCAAGTATGCGCGCGTCGCAGGTTTTTCTGGCGTTGGACATCGTGACAAAATATCCACATACCTCGCGAACGGCTGGGGCAGCAGCAGCGTC
TGCTTGGTGGCAAAGTCTCCGTAAGTCGGAGCTGCTCATTCATCAATTTGCCAAATCGTGCACACTTGCCACTTTTCCAACTACAGCCATGTGCATCCCC
ATTTGCTTCCCGTGCGACGGCGACGATATGTGCTGCTGCCTCTGCGGCTCGCTCACTGCGTGCTGCTGCTGTGGCGGCAACGACCGTCGCGACGACCACC
AGCGCCGTCCGCCTCCACCTCAGCGTGTCGTCTACGTGCAACCCGTCGTCGTCCAGCAAGGTCCTCCGGGGCACCACCGCGGACACCACGGTCGCTATTA
AGCTTCCCATCAGACAAGACTCTAGACACAAGAAAGACCAGGACCAAGCAACTTCCCAAAGTGATTGTCACCGGTGCCAAGCAACAACTTTCAACGAAGG
GCGTCAAAGTCATCGACAGTTATCACTGATACAAGTTGCAACAATGTACAATAGGAATCTGTGCAGGCGCCTCGAAAGAAGAGGCTATAACTCAATCACA
ATTTTGCAATTCATACGCTTCATTCGCATTTTACATTGACGTAACATGCAGTACATGGCACTTTTAACGCCTTACGCGTTGTGAAGACGGTTCTCGCGCT
CCTGCAGTCGACGGCGCAGCATTTTGCCCGACGCGTTCTTCGGGATCGCCTCAATGAACTGCACCTCGCGCACCTTCTTGAAAGGAGCCACGTTCTCGGC
CACGTAGTCCATAATATCCTGTGGGGTCGGACGCTTCGGACTCTCGGGGTCTTTCAGCACCACGAAAGCCTTCGGGATCTCTTCGCCCTGTGGATTTTGT
CCGCGCACACAGCAGCAATCTGCGATGGCTGGGTGGTTATTCAGCACGTCCTCTAGCTCGCCAGGTGCCACTTGGTGGCCCTTGTACTTGATGAGCTCTT
TGGCGCGGTCGATGACAAACACGAAGCCATCGTCGTCGATGTAGCCGATGTCTCCCGTGCGGAGGAATCCTTCCTCAGTGAAGATAGTTTGGTTGGCCTC
GTGGTTGTTTTCGTAGCCCAGCATAACCTGCGGACCACGGTACATCAACTCCCCCTCCTGGTTCGGCCCCAGGTCTCTGTCCGTGCTCATACAGCGAACG
CGAAGCTCTGTGTTCGGCACGAGTCGCCCGGCACTTCCCGGTTTGCGCATGTGGTCCTCGCCATAGTTGACTGCAGGCGACAGCTCGGTCATCCCGTAGA
TCTGCTTCACATTGAGTCCCAGCCGCTTGTTCACGAGACTTTCGACCTGTTTGCCGATCGGAGCACCGCCGGACACGACGAACTCGGTAGACGAGAGGTC
GAACTCCTCGACTAATGGATGGTGAGCCAGGAAGAGCACAGCGGGCGGCGCAATGTGGGCCGTGCGGATCTGTAGGTAAACAGCATTAAAGGTGATCACT
CTTAACGCAACGTAATTAATGGGTGGGGCTCACCTTGTAC