Description :
From Genome Similarity Track
Location :
scaffold_43:74478- 82779
Transcript NameFunction/comments
Pl_111313hypothetical protein PHYSODRAFT_468503
Pl_111314hypothetical protein PHYSODRAFT_466642
Pl_111315conserved hypothetical protein
Pl_111316hypothetical protein PHYSODRAFT_309438

Sequence
8301 bases(100 bases per row)
TGTCCAGTGCCTGCACAGCACAGTAGCCGTGTGAAACAAGGTCTGTTCGGACACTTCGAACAAAGCCTGGTCATCGATCAGATCAATCTTCAAAAGTCGT
AATCGACTCGATCATGGCGCTGAGTCCTTGCCAAAGTCCCGTGCGAAGACGTTCTGCTTATGCTCCTCGGAGCTGTATGGCGGCCGTGGCGCGAACAGTA
GGCATTTCGTGGTGTTGAACCGACCGCAGTGGCGAATTCCAATGCGACGCGCTTTATCGCGGCCCATTCGTTCTCGCAGCTTCGACAGTAAGTGTGCTGG
CGCTCGTGGGTTTTCTCCACCATGCGATCTGCGATAGTTCGAACTTTACGCACATACTCTTCATTTGTCCGGTGCGCTTCGTTCAATTGCTCATAACTCG
TTTTTACTGCGAGTGAGGTTGAAGAGGACAAGCAGCGAAATGTTAGTACCGTACCATCGTATATGTACGGAATCCACATGATCTTACCAATATGTTTGTA
TCTCTTCAACATCGCGTTTGTATTGTCCAATTCGCTCTGGATCTGCTGCATCCGACGCGTGGTCTGCTCGAGTTGCTGCCCTCGACGCACAAAATCGTTC
TCCAGTCGAAACGAATGGCTTGAGGTCATTCGCTGAATCTCGTAGACACGCTCCAGCTCAATCCTCAGTTCTCTCAGCTGCTCTGGAAGACGCGATGCAG
TTGGTACGTTGCAAAATGTTTTTTTGCAACTAGAACTGCTACGGTTTGCACCCCCAGCATCAAAGGATAAGTACAATGGAATTGCGTTGTTTGTGCTGCG
TCGACACACAGGACAAGTTCGACGGAGTGAAAGTGCTTCCTTTACGCAAACATGGTGGAAAACATGGCCACACTCCAAAGCTGCCAAGTTTTCCTCCATT
CCTTCGAGGCATATGGCACACGCATTAGCGACTTCGAGATGTTCGCTATTCGGTGAGAACGAAGCAGAACTTGGACCACAACGAGAATTTACGGGATACT
GCCTCGCCATGGGAGCTTTTGAAGTGATTTCAAGTCAATAATGCAGCCGTCACATGATGGGAGTAGACGTCAAAAGAAAAGGAGAAGAAACACCTCTCTC
ATATACTGTAGTCCGTCGTGGTTGTCTTCAATCAAAGTTGATATGGTACTTTTTGGTTTTATGTATACTATCTCTGCGTTCAGGCACGTAAGGCCTGCCT
AAATGTGCAGCATGGCTGCGATGTAGGATGCACTGGGGCGTAGCGATGGGTCGTACTGAAGACACGCGCCAGCCAGCTCACGGACCATGGTGGGGCATTC
GGGTGTGAAAGTAAACATTCCCATGAAGCTCGTGTCATCGTTGTTTTGAGTACCCAAGACAGGAGTGGTTCGTCGTCGGTTTTCCTCCAGAGCAAGACTA
CGCGAACTCTGCAGTGCACGTGAGCTGTTGGTACTTGGCAAACTTTCAAGCTGGGTGGTACGTCGACGCGAGTTGTCTGAATCACTACCAGTTGTCACAA
CTGTGCCATCAGTGGAAAGAAGAGTGCCGTTGTCTGTGTCGAAATCACCAATGTGCGTACGCATTCTCCACGAACTCCTGATCATTTCATCCGCAGTTTG
GCACGTGTCCAGGTGTGCAAGTAGCACACCGAACGCATACATATCAGAAGACGACCGAGATGGCTCACCAATCAGGATTTCAGGAGCGAAAAATGCCTTA
GTGGTCGAATCGCAATAGCGGTAGTACGATTGACAGCTATACCGTGATGATCCGTCGGTAGGGAGTGCTGCCTGAACCGGGTTCAATTTGCAGCCCTTGT
CGGGATCCACAAACACAGATCTACCGTTCAGTCCGTCATAAGTGACCATGTGCTGGCTGTGCAGATACATGAGCCCACGCGCGATCTCAGCTGCTGCTTT
CATCTTGAAATTTTTCCAGTTGAGCTCTGAACCAGCATTTCGGAGATATGCTTCTAGCGTGCCCAGTGTCATATATTCACACACTGCAGTCATAGCGTGA
CGTTCGTCCCACACAAGTCCAGTAATTGAAAACAGTTGTGGATGACGCATTTGTGAAAGTCTCGGGACCATATCCAATGCTGCTTCCACATCATCATCAC
TTGGCTGAAGTTTAGTAACGAGCACCAAACGCGTTCGATGTTCAGCAAGCCCGACAGTCACAGGACCAGAAATTGACAACTGGTTCAGCATGACCATGTC
TGATGCTGGAATCTCCTTGAATGCAGCCTTGCGCAGACCACCGCCAGTGTTATACTCGTTCAGCGATGTTTCAAGGTCTGTAGTCTGGATTGTAGTGTTA
GAGACACCCATCCGCTCTCGAAAGCTTTTCAGGTTGGCCTTGATTTTGCCATCGCCTGACACAAGCGAATCGTGTTGTTCTGTAGCAGCCTTTTTCTTCC
ATTGTCGTAGAAGAACAACGCCGCCGACCACAGCAAGAACAACGAATAGCGTAAGGCCAAGAACAACAAATAGCACGACAGAGCTGCTGTTGCTCTCGCT
TGCTGTAGAAGTAGTGCTCTCTTCCTTGGAACCGTCACCATTAATACTGCCCAAACCGTCACCGTTTGTATAGCACACGCTTTTGTCGGCCCACGATACT
GCTTCATAACCTGTGGAGCAGCTTCCATTGACTGTTAGGTTGGCTTCAAAAACTGGCAGTTCTTGCAAATACTGGAGCTGTGGAAGAGTGACGTGAGCGT
CTGCGATACTGTTGCCTTGTAGATACAAAGCTGACAGGTTGCGCATTTCATAAATAATGGAGGGGATGTCCGATAGTTCGTTGTCGCGCAAGTCTCTGCA
GAAGAAATAGATGATGTCAGTATTTCACCGCAAACACCTTGAAATTGCGCACGTACAAAGTGGACACCGACGTAAACGCATGCGAGCCACGCGGGTCAAA
TTGAGTGAGTTTTGATCGCTGAATGATACTACACACGTAAAAGTACAAATTAGTTGAAACTTCAAAAGAGGAATACGCATACCAACGTACAGAGTCTGAA
GAGTGTCTGGAAAAATGTTGGTGAGCATATCACCTACACTAACGTCTGAAATGATGCTATACAACCAAAAACAACAACTCTGTCAGTACTTGCACCCTGT
CATACATTCACAAACCGCACGCACATTTGCTGTAGTGCTGAGCCATTGCGGAAGGCATTCGACGAAAAGGAGAGCGGGACAATGATCTGTGAACTAGCCG
TCGCACCGACGATCGACCTGCAAATTACAACCACGTCAGAGGAACTGGAGCATCATGGGACCTCGTTTCCACGTACAAATTCTGCAATGTAGGCGGCAGC
ACCAGGTCGTCAATCTTCTGGAACACGGCGGTGTCTGCCTTATCACTCTGAGGCTGCGCGATCGTCAGTGTCCACTGTGGCATCCCCCAACTAGCCCACG
TATCCACTAGACATTGCACCTCACAGTTCCCTGACGTCACCTTGGTCTTGCACGTCGGCATACTAGCTGATGAGCAGCCTTTATAGAGGAACCCTCCATC
ACTACTAGTGCTCTTGTCTTCAGACGCCGATGACGCGTAGTTCACGCAGAGTGATGAACTGCAAGCCCCGTAACAATTGCTCATCAGTGTGTTCTGGTCT
GGTGGGCTACACACATCTTCCGCCTTGACAGCAACTGTCAACGCTGTTGCCACAAACACCGCGAGGGCCTGAATGCTCCTCATGTTGCCTGTTCTCGTTG
TGAGAAGGAGTTTGACACGTTTGCACCCTCGCCACGTTGTTTGTCTCTGGAATATGGTTTGCAGTGGAGAGAGTTTGTCAGATTGGTCTCTTGGTGCAGC
GACTGCAACTGACCGCCTACCGCCAAGTTGGTGGGGTTTTCGCGTTCTCACTCCGAGTGGCAACACGCAGAGGCAACTAGTCCGCGAGAGGCAATTAGTC
TGCGACTCGAGGGAGTTCTGGCACGTATCGGGTGGGCAAATGGAGCAGCACTGCCTGCTGGCAGTCCACAGCAAATGTCCCACTCGCTGATGGGGCGACT
TGCGTGCATAGCCAGTGCGTAAAGCCAGTGTTTTGAATTCGTTTCACGACAAATGTTCACTTGCGTTCACTATGGTTCGTAACGTGGGCCGTTATTGCAG
AAGGCAAGTTCCTCGTCAAGGCTTGTTTGGCTCGAAGGTTGTTGCAAGAGACCTTCTTGTTGCTCGATCTGTCGTCGTGTAGATCGTTCCGAGTAGAGTC
CGTGCGTTTCGTGCCGTTGACGCTCGAGAGACCACAAGTGCATCAGCGCCACAACGACGAGGACACCATGTATTGCTGCAACTGTTACGTGCTGTAATGC
TGCTGTTTCTCGAGCAAGGCCGTCTTCTCTACGAGGAGCTCAGGCTACCAAAAGCGTGCCTCCACGAGTCTCGCACAGACTGTTTGACTCATACACAATC
TGTGCGCAACATTCGAGTCACTGTGACGGCCACCCCGATGGATACCGACGTGCGGCTCCAAAGGAAGGGCTTAGTGCGAGAGACATGGCTAGTGTTGACA
GTCGCTTTCGACCACTTCGACGCTGACCAAATGCCATTTCGCTGATTTGACTAGGAAAGGCGTGCTGAACTATCTAGCTGCGTTGTCAGCGTGCGGAGTG
AATCTTTGGTTTGCAGTGGACAAATCCATTTCTCATCGATGATTGTGTTGCAATGATTGCACCGGGAGTTTGTCATTCCTAAACTAGGACGACCTAATTT
TCGGATGGATTCTAATTTCGGACAGAATCTAATATTCGTAACGGTTGCTGAGCTCGTCAACTGTGCGCATCATCAACTCCGATTTAGACATGGCTTCGCT
ATTTTCGTAGCCTGCAACAGGTGGTGCTCGTGATAGACTCTACCAGCGAAGAGAGCACATAGGCAAGCAGTACGGGACAACATTTTACAGGATGAGCGTC
CGAAGGTTGCGTGAAGCGACCAAGACAACACCTCGAAGTATCCCTGGTACGCTGCGTTCGTAGTCAATAGAAAATGATACGCCTCTGACTTGTGTTCGTT
ATGCAGGAACGCCTCATAAAGCTGAAGAGAATGAGCACGAATACCTCCGGCGCTGCGTGGATCCAGTCCTGATGCCGCTCATTGAGTCGCTGCTGCTTTA
CCAACCGAAAAGTGTCTACCACTTCATTCACGACTTCGTGGATGAACAAAAGGCCGGCCGCTTTTCACACCACTCGAGGAACGTAGGCTACGCCAAGAAG
CTTACCAATCGACGAAAGATGGCGGACTTCATGTCCACCAGTGTGATCCCCGTTATGGATGACCTGGCCAAACAAATTCTACGTGAAAAGCCAAACTCAG
TCAAAGGTGAAGTTTGCTAGAGCAGGGATGAAAGTACTGAAAACTAACCGTCTGTGTTGTAAAGCTTTCATTAGAGACGTGGTTGCTGCACGCATCATTA
TTGAGTCCAGAGAAAGTTTGGAGGGAAACCAACTCGAAGCTGATGCTCATTTCAAAGTGAACGATCGTGTATTATGTCGTTATAAGGGTCGACCCCGATT
TTTCCCCGGCAGTATTACAGCTATCGACGACGACGGTAGCTTCACCGTCTTATATGATGATGGAAAGACAGAGAGCAATATACATGTCATGTGTCTGAAG
CTTCACCCTACTCAAAATATCAACGGGACAGCAGTAGCACAGAAGTCACGAACAGAAGAACCTGAGCACAACCAGGACATACTGAAAGTCACCCGTACAA
TGGAGATCGTGCTATTGATCATTGGTATAGATGGAGCTGGGAAAACTACACTACTATCCACTTTACAAGGTGATCTGGATAAGGAGCACGTACCGAGTGC
AGGCTTCACGTCTGCCACATTCCAGACAGAAACAGGATCTGCTACATTTTACGACCTTGGAGGTGGCCCTGCATTTCGCAACGTGTGGAAGGAATACTAC
GCTGACGTAAGTCTGCCATTGTTGATACCTTCTCTTGTACATTTGTATTAACACCCGGATGGTGCTCAGGCTCATGGTGTTATCTTCGTGGTCGACTCCT
CAAACGAAAATTCAATGCATCAAGCTGCAACCGTGCTCGAAGAAGCGATGGCAAACGAACTCATGGTCAATAAACCGTTGCTAATGTACGTGCACTCGGA
TTCAAATGGCAACAGCCATATGCCTTACTGATCGAAGTATGTCAATTGTACAGTTTTGCCAACAAACGAGATCATTCTGACGCTGTAGGAGAACAGGAGT
TGCAGAACTTGCTATGTTTGAACAAATTCCCCAGTTCCAAGATCAGCCCCTGTATTGCTAAGCCTGCAGTTTACGGCGGTGTGGTAGACAAACGTCTGGA
AGCAGGCCTCCAGTGGCTCTTTGACCAAGTTCACAAGAAATTTGATTCACTCCATGAACGAGTTCAACGTGATCTTGCTCTGAAGAAGAAGCTTGACCAG
CAACGACGCGAAGAACAACGTGCCCGGGTCTCACGTTGGAAGGAAGAGCGTGAACTCAACCATATGCGCACCCATGACAAGTTGTCAGTCAAGGAGCATA
CATCATCCTTCAAGGCTGTGATTGATGCTCCGGAAGAGGTCGTGATATACTGCTCAAGCTGTATTACGGCACCAGCAGTAACAAAGTGTGCAGCGTCCAA
ATGGATGCCTGTTTGCGAAGCTTGTGCCACAACTTTAAGAAGTCATTCCGCATAATCATCCATTATACTCCAACCACTATCAAAGCTCTAGTGATCTTGG
ATTTACAGATTCCAGCCTCTATCTTCGCTTTTTGCCCTTTTTCCCACGACCACGCTCTTCCTCCTCTTCCTTCTTCTCCTTTTTCGACCGTGCACCGCTC
ACGATCTTCTCTACATTTTCTTTTTTCTTGTTCTTGCGCATCTCCTTGCGCTCCCGACGCTTCTCGGCTGCCTTCTGCTCCTTTTCAAGTCGCACACGCT
CAGCCTCCGCCTTCTTTAGTGCAGCCTCATCATCTGCTTCCTGCTGCTCAGTATCGACATCCTCCACAGCATCTTCAACAGGCGACTTGGTTGGCGCATC
AGTGTCATCACTAGCTTCAAGCTTCACCTTGCCAAGAGCGATAAGCTCCTCTTGAAGTGCCTTGTCCATTTCATCATCCAAAATGCTGAGATCGCTATAC
ACTCCGAGCTCCTCCTCTTTCTCACGATGCTTTTTCGATGTGAGGTGGTTCTGCAGCTGCTTCGTGGACTTGAACGTCTTGCTGCACAAGTCACATACGA
GAACATCTGCATCCATTTTCTTTCGCAGCTTTTCGAGTTCCTGCTCGATATCTCTGTCTGCAACACGACTAGTCTCCATGTTGTTGTCAGCCCAGAGCTT
CTCCTGCTGTTCTTGAAATGCACGTCGCTCGGCATCATACGCAGCCTGCCTCTCGCGTTTCTTAGCCTCTTCTTCAAGTCGGCGCTGTTCCTTCTCCTGT
TCCTTCTGTTTCTGAAAGGCCCGTACACGCGGATCGCGACGAAACACGAAATCCACAAGTTCGCGCACTTCAGTAGTAAACGCCTTCTTAGCAGCATCTC
GCAGCTTCTTGTTTTCCTTCTCCATCGCTCGTCTCACCAATCTCGTGGGTGCGTCAGTCGTCTTATACTCATCCACCCACGCAAAACTGCGCTGGGTCGT
GTAACTCTTCCAGTGCTGGTAAAAGTAGTTGGCATCATCCATCGGCGTTGTTGTATTACCAAGCTCTGGTGCAACAGAACTCGAACCATCACCACCTTCC
AAGTCCAGTGCATCAATCTGTAGCATAAAATAATCATTAATGTTACAATAAAATAAAGCCACTGCATTAAACTGCAGTCGACGTACCTTAGTAAAGAGTT
CACCGTACACAGAGTAGAAGCTCTTTTCATCCGTGCCGAAACCCGAATACACCGAGGCACTGAAATACCGGAAAAGGTTGAGTTCGTCCTCGTCTTCATC
TTCCTCGTTTCCATCTCCACCGCGTAGAATTTGCTCACGGTGCTCATCATACCATTTCTTCTCATGTGGGTCGCTAAGTACCTCGTAAGCGTTCTGGATG
GTCTGGAATTGTTCTGTAGCTTCCTCATTCGAGATACCGTTCTGCTGGTGCTTGTCCGGATGCCATCTCAATGCTTGCAATCGAAAAGCTTTCTTGATCT
CCGCTGCTGACGCGTCCCGCGCAACAGCCAACACCTCGTAGTGGCAGCGCATGTCAAGCCAGCGAAAATATATAAATGTGCATACACAAAAAATGAGCAG
GACTAAAAATAGTCGTACTACTGAAGTGCTCGCTTCAACCTGACCACTTTTGCTCTGATGTCTTTGGCCTGCGGATACTCACATTGGATCATGAACGCTG
A