Description :
From Genome Similarity Track
Location :
Scaffold_16:74473- 77319
Transcript NameFunction/comments
g18061.t1hypothetical protein

Sequence
2846 bases(100 bases per row)
GCAAGTCGCGTCGCTCCGACGGCTTCTCCCGTCGCCGGCGCCGCGCCAATAGCGACGAGGACTTGGCCTCTGCTTCCCAAGACGCCGAACATGACTCCGA
TGTCGAGATTGTGCGCGATTTCAGTTCCAAGCGCGCGCTAGAAGCCGATCCAGACGCCTCCCAAGTGTCCCCGGAGGAGCGCGAGCGATTACGCGACCGC
GAGGAGCGCGACGCATTCGCCGAGCGATTGCGTCAACGGGACGAGGACCGCACGAGGCGCAAACGCAAGGCGGAGGAGCTGGAGGTTGCCGGGGGGCTCA
CGGGTGACGAGATCCAGCAGCTGGCCAAGAGAGGAGCCGTAAACGACGACCAGAGCGCGCTCAGCGACAAGCTGCAGCGCCTGAGAGAGCTCAGCAGACA
GGAGTACCTTAAAAAGAGGGAGGAGAAGGAGCTGGAGCTGTTGGAATTCCAGCTCAAGGACGAGGACGTGCTCTTTGAGGACGGCAAGAGGTCCAGGAAG
GAGCAGCAGCAGCTGGAGCTCAACAAGAGGATCCTGGAGACTGCTAAAGCTAGGTCCCAGAAGGAGGAGGTTGACGGGTATCAGATCCCAGACTCGTACG
AAGAAGTGGACGATGAAGGCAACAGGATCAGGAAGAAGGAGGACTTGTTGACGGACAGATACGAGGAGGAGGAAGTGGTCCATACAGAGCAGGAGGTGTG
GGAGGACACGCAGGTCAAGATGGCAACGAGCAGGTTCGGGGTTAAGGAGAGACACAGGGAAAAGAAGGAGGAGGACGAGTTCGTGTTCGACGACCAGATC
GACTTCATCTCGCAGCAGATGCTGTCGGGCCATCATGTGAGTGAGGAAGACGTCCAAGAGGCGAGGAAGAAGATGGAGCAGGCGAAACACTTGAGTATCC
AGGAAGGAAGGAAGCAGCTGCCCGTGTATCCTTATCGGGAGTCACTGCTGGAGGCGATTCGGAATTACCCCGTGATTATTATTGAGGGGGAGACTGGGTC
AGGCAAGACGACACAGATCCCGCAGTTTCTGCATGAGGTCGGGTACTCGGAGCTCGGTATTATTGGGTGCACGCAGCCCCGACGTGTCGCTGCGATGAGT
GTGGCAGCTCGTGTGGCGCAGGAGATGGATGTGAAGCTGGGTAACGAAGTGGGCTACTCTATCCGTTTCGAGGACTGTACCAGTGACAAGACGGTGATCA
AGTACATGACAGATGGTATGCTGCTGCGTGAGTTCCTGACCGAGCCTGATTTGAAGACCTACAGCGTCATGATCATTGATGAGGCTCACGAACGTACTCT
CAGCACGGATATCTTGTTCGGCCTGATCAAGGATATTGCGCGTTTCCGAGACGATATCAAGATCATTGTGGCCAGTGCGACGCTGGATGCGACCAAGTTC
AGCGCCTACTTCGACGACGCCCCAATTTTCAAGATCCCTGGACGCATGTTTCCTGTGGATATTCTGTACACGAAGGCTCCGGAGGCAGACTACCTGGATG
CGGCTATCGTGACGGTGCTGCAGATCCATATCACGCAGCCTCTGGGAGACATCCTCGTGTTCTTTACCGGTCAAGAGGAGATTGAATCAGCTGAAGAGAT
ATTATTGCAGCGCACCCGTGGTCTTGGCTCGCGAATAGGCGAGCTGCTTATTCGACCAATTTATGCGACGTTGCCGTCGGAACGCCAGGCCCAGGTGTTT
GAACCAACGCCTGAGGGCGCTCGCAAAGTGGTGCTGAGTACGAATATTGCTGAAACATCGCTGACCATCGCGGGAATCTGCTACGTGATTGACACGGGCT
TTTGCAAACAGACCAACTACAACGCGCAGACGGGCATGGAGTCCTTGCTGGTGGCTCCAGTGTCGCAGGCTATGGCGAACCAGCGAGCCGGTCGCGCAGG
CCGTACCGCTCCGGGCAAGTGCTTCCGTCTTTACACGGCGTGGTCCTACAAGAACGAACTTGACGAGAACACAGTGCCGGAAATCCAGCGTACGAACCTC
GCCAGTGTTGTGCTGCTCATGAAGTCACTCGGAATTAACGACTTGCTGCACTTCGACTTCATGGATCCGCCGCCAGAGAAGGCGCTCATTCGCTCTCTTG
AACAGCTCTACGCCCTCGGCGCCCTGAACGGTTTGGGTGAGCTGACAAAGCTCGGACGTCGTATGGCTGAGTTCCCGCTGGACCCGATGATGTCGAAGGC
TCTACTCGCCTCAGAGAAGTTTGGCTGCACCGAGGAAGTGATGACTATCTGCGCCATGCTGAGTGTGAACAACTCGATCTTCTACCGACCGAAGGACAAG
GCCGTTCACGCTGATAATGCGCGACTCAACTTTGCACGTGGCGGCGGCGGCGACCACATCACGCTGATGAATGTCTACAACCAGTGGGTTGAAACGAACT
ACTCGACGCAATGGACGTACGAGAACTTTGTGATCATGCGCTCGCTCAAGACCGCCCGCGACGTGCGAGAGCAGCTCGAGGGCCTTTGCGACCGCGTGGA
GCTCGAGAAAACGAGCAACCGCAGCGACCACGAACCGATCCGCAAGGCGGTCTGCGCAGGGTACTTCTACAACACGGCCAAGCTGGACAACTCGGGGCAC
TACAAGACGGTCAAGAAGGCGCAATCTGTGCACATCCACCCGAGCTCGTGTCTGATCAAGCTCGAGGAAGTCCCGCGGTGGGTCGTGTACCACGAGCTGG
CCTTCACGACCAAGGAGTACATGCGCAGCGTGATCCCCATCAAGTCCGAGTGGCTCATGGAGCTCGCGCCGCACTATTACAAAACCAAGGAAGTCGAGGA
CGCCCGCACCAAGAAGATGCCCAAGGCTGTCGGTCGAGCAGGCTAA