Description :
From Genome Similarity Track
Location :
contig_52:74473- 75757
Transcript NameFunction/comments
g9983.t1POM68747.1 Hypothetical protein PHPALM_15046 [Phytophthora palmivora var. palmivora

Sequence
1284 bases(100 bases per row)
ACGGAATGTGGTTCTGCTGCATGAAGGCCAGCAGCATTTGTCGCTCGTTCGGCGGCAGCATATCCACTTCTGCGGGGTCATGTCGCGAGCAAGCTCGGCA
ATGGCGTCGAACTGGCCATCACCACCAAAGCCGCTGGGCTTGGCACGCTTCGACGGGTCATTGTCTCCAGGTGGCGGCATCTGTCCTTGGTCAGCAGAGT
ACGGCCTCTTCGCCAAGCGCGGGTCTCGTCCTGCGCGTCGAGGGTCACGATTAGCATGTGCCAGGTTACTGCTGGGTGGACCACTAGTTGGCGTAGGCAT
CAAGCCAGGCTGAGGCTGCATTGGACTCAGCGATGGTGCAGAAGCTCCTGGTCTGTTAGTCATGGCAGCACTCGATGACTGGGTGACCAATGGACCAGGC
CGTGCGCTCCAACGGGTGCCCCGACTTTGCGGGCGCTGGAGCATGAGGCGCCATCATCGCCGGCTGGACGCCTGGTGGAGCCATGCCTAAAATGCCAGGC
CCAGGCCCCATCAGTCCGCCCATCGGCGGGCGCGGTGGAGGCGGCATCATCCTGCCAGCCATCGGGGGCGGCTGGTGCATCATGGGTGGAGGCGCTAGCA
GCACCGCTTGGGTCTCGGTCGAGGACGGAATGGAGATCTGCAACGTCTTGAAGCTCTGCACAATCGCGTGCGTGAGTGCCGGGTTCGCCATCAGGATGCT
CTTCGTCACGTCCGGCTTCTGTCTGGCGTGCTCCTTCAGTTGTACCAGCATGTCGTACAGCTTGACTGGTCCCAGCCGAGCAATAGCCGACTCAATGGCG
TTGATCGCCATTTCGCCCGTCACCATCGACGGGGGTCCTCCCTCCGACCCGCCGTTCCTGAAGTTGCCGCCGCTGTTTCCTCCGTGCCGCTGGTTCCCAT
TGTCGTGGCGCTTCCTGTCTGCTCCTCCAGACTTGTCCCCGCCGTCTGCAAAGTCCACGCGCAGTTGCGTCCGTTGATCTCGTAGCCGTTGAGGTTTCGC
ATGGCGCTCAGCGCCGTCGCTCCGTCCGCGTACTCACAGAAGCCGTAGCCCTTGGGTTTGCCGGTCTCTCGGTCCGTCACGAGGCTACAAAGCAGGGAAA
ACGTCACAAACTCAGCTCCAGAACCTTGTTTCGCCCCCGTTGAGGCTGTTCCGAGGCTCTCACGCACCGGAAATTCACGACGGAGCCCGCTTCCGAGAAG
ATCTCCTTAAGCATGTCCTCCGTCACATCGTACGGGATGTTTCCGACTGGAGAATTGGAATACGGCGCAAGAGGACACGAAAAT