Description :
From Genome Similarity Track
Location :
contig_52:74452- 75736
Transcript NameFunction/comments
g10447.t1RAW29474.1 hypothetical protein PC110_g14171 [Phytophthora cactorum

Sequence
1284 bases(100 bases per row)
ACGGAATGTGGTTCTGCTGCATGAAGGCCAGCAGCATTTGTCGCTCGTTCGGCGGCAGCATATCCACTTCTGCGGGGTCATGTCGCGAGCAAGCTCGGCA
ATGGCGTCGAACTGGCCATCACCACCAAAGCCGCTGGGCTTGGCACGCTTCGACGGGTCATTGTCTCCAGGTGGCGGCATCTGTCCTTGGTCAGCAGAGT
ACGGCCTCTTCGCCAAGCGCGGGTCTCGTCCTGCGCGTCGAGGGTCACGATTAGCATGTGCCAGGTTACTGCTGGGTGGACCACTAGTTGGCGTAGGCAT
CAAGCCAGGCTGAGGCTGCATTGGACTCAGCGATGGTGCAGAAGCTCCTGGTCTGTTAGTCATGGCAGCACTCGATGACTGGGTGACCAATGGACCAGGC
CGTGCGCTCCAACGGGTGCCCCGACTTTGCGGGCGCTGGAGCATGAGGCGCCATCATCGCCGGCTGGACGCCTGGTGGAGCCATGCCTAAAATGCCAGGC
CCAGGCCCCATCAGTCCGCCCATCGGCGGGCGCGGTGGAGGCGGCATCATCCTGCCAGCCATCGGGGGCGGCTGGTGCATCATGGGTGGAGGCGCTAGCA
GCACCGCTTGGGTCTCGGTCGAGGACGGAATGGAGATCTGCAACGTCTTGAAGCTCTGCACAATCGCGTGCGTGAGTGCCGGGTTCGCCATCAGGATGCT
CTTCGTCACGTCCGGCTTCTGTCTGGCGTGCTCCTTCAGTTGTACCAGCATGTCGTACAGCTTGACTGGTCCCAGCCGAGCAATAGCCGACTCAATGGCG
TTGATCGCCATCTCGCCCGTCACCATCGACGGGGGTCCTCCCTCCGACCCGCCGTTCCTGAAGTTACCGCCGCTGTTTCCTCCGTGCCGCTGGTTCCCAT
TGTCGTGGCGCTTCCTGTCTGCTCCTCCAGACTTGTCCCCGCCGTCTGCAAAGTCCACGCGCAGTTGCGTCCGTTGATTTCGTAGCCGTTGAGGTTTCGC
ATGGCGCTCAGCGCCGTCGCTCCGTCCGCGTACTCACAGAAGCCGTAGCCCTTGGGTTTGCCGGTTTCTCGGTCCGTCACGAGGCTACAAAGCAGGGAAA
ACGTCACAAACTCAGCTCCAGAACCTTGTTTCGCCCCCGTTGAGGCTGTTCCGAGGCTCTCACGCACCGGAAATTCACGACGGAGCCCGCTTCCGAGAAG
ATCTCCTTAAGCATGTCCTCCGTCACATCGTACGGGATGTTTCCGACTGGAGAATTGGAATACGGCGCAAGAGGACACGAAAAT