Description :
From Genome Similarity Track
Location :
Scaffold_107:74448- 76276
Sequence
1828 bases(100 bases per row)
CTGCAGATGTCCACTGCGGACCATCCGAAGACCGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCAC
CACGTACGTGGTCGACGCAGCTCCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAACGGCTTCCG
CCACCCCAGAGTGCCTCTCACTCTTTGAAAAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTG
AGGCCATATTCGCTGAGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAAC
AAAAGGAGTACTCGGACAAACAAGGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTG
TTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGAACCCTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGT
CAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTCAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCACCCCTTGGCCCAGCTCCAC
AAAGCGAGGGCCGGTCACAGACATCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGG
GCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCG
GACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGAC
CTATTGCTCCGCCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCA
ATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCG
CCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCTACTTCCACGTAGAGCGGATCCTCCAGGAGCAACGGTGTC
GCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGT
CGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCAT
CGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGAT
GTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAAAACATGTCCTCACAAGAACTCCAT
GTGGGAAAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAATTCCTTAAGGG
GAATGCGGTGTGGCGCGAGAAGCACACA