Description :
From Genome Similarity Track
Location :
Scaffold_332:7444- 9204
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_332-snap-gene-0.7ATP-binding Cassette (ABC) Superfamily

Sequence
1760 bases(100 bases per row)
GCCGCGGGGCTGAGTCTCCCGGCTCACATGCCCCAGCTCGCGCGGAAGATGCGTGTGCAGGACGTGATCGACGACATGGGGCTACGCAACTGTGCTCGCA
CGCGCGTGGGGGATATCTTCCACAAGGGCATTTCCAACGGCCAGCGGAAGCGCCTGAGCATTGCCGTGGAGCTGCTGTCGAACCCGTCGATCCTGCTGCT
GGACGAGCCAACGTCAGGGCTCGACTCGTCCTCGGCTCGCCGCGTGATGGAACACATCGCGCGCCTGTGCAAAGAGGGCAAAAACATCGTGTGCACAATC
CACCAGCCGTCGTCGGCGATCTACGAGATGCTTACCAACCTCGTGATCCTGTCCATGGGCGAGCTCGTGTACTTTGGGCCCACGAACAGTGCGCTCACCC
ACTTCTTCTCGCTCGGATACGTCTGCCCCATGTACGTGAATCCGGCCGAATTCTTCGTGCACCTCGTGAACAAGGACTTCCACGACCAGCTCGACATCGA
GCCCTTTGTCGGCGCTTGGCAAGACTCTGGCGAGGCGAACCGACTGAGACTCGACATTGCGCGCGACCGCGCCAAGTTCAGTGCCTTTGACGACCAGGTA
CTCCAGGCGCTGGCGCCGTCGAACTGGAACCAGTTCTGCGTGCTGCTGCAGCGCAACTGGGTCAACAACTGGCGCAACCCGGGCGTGTTCTGGATCCGCG
TGCTCATGTACTTGCTGCTCTCGCTCATGGTCGGCACCATGTACCTGAGCTCGAACGCCAGCATCACGATCGACGCCATGGTGCCACTGCTCTTCTACGT
CCAGGCGTTCCTCGTGTTCATGTCGGTCGCAGCCNNNNNNNNNNNNNNNNNNNAGGGTCCGCGTGCTCATGTACGTGCTGCTGTCGCTCATGGTCGGTAC
CATGTACCTGAGCTCGAACTCCGACATCACGATCGACACCATGGTGCCGCTGCTCTTCTACGTCCAAGCGTTCCTCGTGTTCATGTCGGTCGCAGCCATT
CCGGCGCTCATCGAGCAGCGCGCCGTCTTCCAGCGTGAGGTGCTCAACAACTCGCTCAATCTGATAAGCTACGCGAGTGCAAACCTGCTAGCGGCGCTGC
CGGGAATCGCGTTCATCTCGGTGCTCGCGTCCGTCATCGTCGTGTACTTTGCCGATGTGAACTCGTTCGGGTCCTTCCTGCTCAACNNNNNNNNNNCCCG
GCGCTTATCGAGCAGCGCGCCGTGTTCCAGCGCGAGGTGCTCAACAACTCGCTCAACCTGCTCAGCTACGCGAGTGCGAACCTCCTGGCGGCGCTGCCGG
GGATCGCGTTCATCTCGGTACTCGCGTCCGCCATCGTCGTGTACTTTGCCGAAGTGAACTCGTTCGGGTCCTTCCTGCTCAACCTTACGCTCTCGCTCGT
GGTCTCCGAGTCGCTCATGCACGTGCTGGGCGCCGCCGTGCCGCACTACATTATCGGCATCGCGCTCGGCGCGGGGCTCTTCGGCATGTTCATGCTCTGC
GAGGGTTTCATGGTCCCGGCGCACTCGATCCCGACCTACTGGCTCTGGGGGTACTACCTCGCGTTCCACACGTACTCGTTCGAGAGCTTCATGTACGAGC
ACTTCTCGCGCGTCGACACGCCCGAGGCCTGGGCCGTACTCAGGCACTACGGCATGCAGAGCGTCAACGTCGGTCGGGATATGCTCATCCTCGTGGGCTA
CGCGGCCGTGCTCCAAATCATCTTCGTGGCGATCCTCTACTTCTTCCGCGGCGGACGGCG