Description :
From Genome Similarity Track
Location :
Scaffold_105:7443- 13254
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_105-snap-gene-0.30Polyribonucleotide nucleotidyltransferase
Pytir_DAOMBR486maker-pir_contig_105-fgenesh-gene-0.2Pre-mRNA-splicing factor SF2
Pytir_DAOMBR486maker-pir_contig_105-fgenesh-gene-0.11RL38, ribosomal protein 38 60S large ribosomal subunit

Sequence
5811 bases(100 bases per row)
CAAGAGCGCCTTGAGCGACATCTTGCCCGAGAAGCCCTCCTGGATGCACTGGAACTCAAGCTCCTGGCCGACCGAGACCACGTCGTGGATGTTCTCCACG
CGGGTGGCTGCGAGCTCCGTGATGTGCACGAAGCCGCGGTTCTTGGACGGCGCAGTGGACTCGAGGATCGCGCCAAAGTCCATCACTTCGGTCACGCGCA
TCGTGTACTTGCTGCCGCGCTTGAAAAACGCTTCGCCGCGTTCGCTTCTTTCTCCTCGTTCACTTCGTTCTCCTGCTTCCGTCGTCTGGGTCAAGATACG
CTGCTTGGCGTTCTCCGCGTTCTCCGGCGAGCCCACGACGCGGATCGAGCCCGCACGGCGGTCGATGNNNNNNNNNNNNNNNNNNNNNNACCGTGACTTG
GAACGTGCGCTCCAGGTCGCGAATGTTCGAGCCGCCCGCACCAATCACCGCGCCGATTGTGTTCGTTGGGATCGTGAACTCCAGCCCGACGTTGATCTCC
CCCGTGGGCGAGTTCTTGAGCTCCTTGCGCGGCTCGGCGATCGTCGCGTTCATCTTGCGCAGGATGTTGGTGCGCGCCTTCTTGGCGTAGTGGATGCCTT
TGCAAAGAATCTCAAGCGGGATGCCCGGCAGCTTGACGTCCAACTGAATCGCCGTGATGCCTTCGTCCGTGCCGGCGATCTTGAAGTCCATGTCGCCGTA
GTGGTCCTCCGTGCCGAGGATGTCTGTGATCAGGCGGTAGTTCTTGATCTCCTTCTCGCCGTCAAACGGGTCGCCCTCGGTGATCAGACCGATTGAGATA
CCAGCCACCGGCGCCTTGATCGGCACGCCCGCGTCCATGAGCGCGAGCGACACACCACAGACCGTCGCCATGGACGACGAGCCGTCCGAGCCCATGGTCT
CCGACGTCATGCGCACCGTGTACGGGAAGTCGTCGATCGACGGGATCACCGGCACGAGCGCCTTCTCCGCGAGCGCACCGTGGCCGATCATGCGGCGGTT
TACGCCACCGACGCGACCAGTCTCGTTCACACAGTACGGAGGGAACTCGTAGTGCAGCATCGCGTGCTTGAGCGGGATGTCCTTGCTCGGGTCCATCAGC
GCCGAGCGAACCTTGAGGCCGCGGTCCAGCGGGCCGAGCGTCACGGAGCACAGCGCCTGCGTGTCGCCGCGCGTGAACACCGACGAGCCGTGCGCCATCG
GCAGCACGTCCGTCTCGACCTTCAGCGGACGGATCGTGAACGCCGAGCGGCCGTCGTAGCGCGAGTTCTTGTCGCCAGAGAGGATCTGCTCGCGCAGGGC
GTACTGGAACACGTCGTGCGCTGCCGCCTGGAACTGGCTGTCGTCCATGTTGCGGCCGTGAAAGTNNNNNNNNNNNNNNNNNNNNNNCTCGCGGAGCGTC
GAGATGATCTTGCCGTACACGTGCTTCTCGCCTTCCTGGCGCTCAACCTTGGTGAGCTTGGGCGAGCTGAGCACAATATTGGCCTCCTCGAGACCGGCTT
CCTTGGCCTTCTCCATCACTTCCGGCTCCACCACGAGGCGCATGTACGTGCGCTTCTCCTTGCCAAACTGCTTCACGAGCTGCTTCTGGGTCTCGATGAC
GGGACCCACAGCGTCGTGCGCGAACTGGAGCGCCTCCGCCATGCGTTCTTCCGTGATCTCGTCACCCGACGCCTCGATCATGAGCGTGCGCGTCTCGTTC
GCAGCGTACAGGATGTCAAGCGTCGCGATGTCGCGCTGCTTCTGGGTTGGATTCACAACCAGCTGGTCGTCGATCTCCACCACGCGCACCGCGCCGACAG
GTCCGTTCCACGGGATGTCGGACACCGCCAGCGCCGCCGACGTGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGTCCAACGA
CTGCACGGTCGCGATCACCTGGGTGTCATCGTAGTAATCGCGTGGGAAAAGCGGGCGGATCACGCGATCCACCACGCGCGACTGCAGGATCTCCTCGTCC
GTGCCGCTGAACTCGGTGCGCTTGGCGGTGTCCGGGATCAGACCCGTCGCGTAGTACTTGACGCGATAGTCGACCATGAGCGGCAGGAAGTCGCGGCCGC
GTTTGCCTCCCACCGAGCTGACCGCAGTCGTGAGCACCATGGTCTTGCCACACGTGGCCATCACGGAGCCGTCGGCGAGGCGCGCGTACTTGCCCACCGA
GAAGCTCGTTTCGTCTAAGGAGCCGACGATTTTCTCGGGCACAACTGGAGCAGCAGCAACAGACGCACTCTCGCTGACAGCAGCAGCAGCAGGACTGCTT
GTCGCTGGAGTTGGCAGTGTGCTCTTCTTCTCCTCCACGATGGCTTCGTCCTTCTTCCCGAAGAGCAAGTCGCGCAGTCCGAAGAACGAGCGCGTCTGCT
GCTGCACAAAGTGCTGGTGCACATGGTACCGGCTCACACTGCTGCTCGTAGTGGTGTTAACACCATTGCCGTTGACGCGCTGCAGCAGGCGAGTCGTCTG
TTGCTGGTTCTGTTGCTGCAGACGCGCAGGGAATCGACGGCCAGCGCGCAGCATCGTGCGTGCGTCAAGTCGATCTTGGGAATGGCGATGATGGCCCGCT
TGGGTTTCTGCTGGTGCTGTTGGTTTGGATGGCCACACAGAAACAGCCCAAGAAACAGCACAGGTAGGTACTGGACGCCCTTCAATAGAAGATCCACTGT
CCAGCTATATGTGTGAATATTAGTAAACTTTCAGTATCAGCTGAGCAGTTTTTCTGAAAACAGGTCTCTTTCCGTTTGCTGTTTGAATAGTTTTCTAAAC
GGATAGATCGCTGTACAGCCTGGAAGCAGAAAGAAGACCGCCTTCTAAATGGGTCCATGCCTGTACATCCGGGGGCGGTTTGGACGCCTTGAAACCAACC
CTTCGGTCTTCTTTCCCCCCTTTGCTTTCGAGACAGCCCAACACTCGCTTTTCAAGCCCCAGGACGCCTCAAGAGCTTCCCACCTCCAAGCCTCTCCTCT
CTCTCTCTCTCTCTCTACGTAACCAGCAAGCATGGGCACTCGTGTGTACGTCGGTGGACTGCCTCGTGACGCCACGTCGCGCGAGATCCAGGACGGTTTC
TCCCGCTACGGCCACGTCTCCAACATCTGGGTCGCGCGCAACCCGCCAGGCTTCGCGTTCGTGGTGAGTGCCTCTTCTTCTTCCTCAGTCGTCGGCTCAA
GCGCGCTGCTGCCGCGTCGTCTGCGTCTTCCCACGTCGTCGTCGCACAGCTAGTTGTGTGTTGTGTGTGTGGGCGTGTGGGCGTGCTCTTCATATTCCTC
TCGGTACGAGCATCGTCGTGGTGGTGATGATGATCTTCGTCTTCTTCGACGGGCATGATGGCGGATCTTCCTCCTCCTCCCCCTCCTCTTCTTCGCATCC
ACCCATATCTTGTGTGTCTTCTCCATCGGCTGTCTGCTACGAGTGGTGTAATGGCGACTCCAAGCCCGACACAGCGTGTTGTCGCCTCGCTCGCTATCAG
TTTAGGTTGATGTCCTTCGGTCGACATCGTCTTCAGCGGGGCTTCCTTCGCATTTTGTAGATGTCGGCTCTTCGTGTGATCTTCGGACGGACGAACCGAT
TGCCTCCTTCTCGGCATTCATACTGCTGTAGCAGCTAGGGTGGCTGCTGACGTCGAGAGTACTCTCTTCTGCTTCAGCTACGGACGTCACCGCTGCTTCA
CGCGCCATCATGCTTCATCGCCCACTTCGCCATCCCCCACACCACAACCTGCGCACCACGCCACGCCACCTCGCCACGCACTAGATCTCCACGTGTGACT
CCAACCAACCAACGCCTCCCATCCTCTCTTCGTCTTCGTTCTCTGCTCGTCGTTCTCTAGGATTTCGAAGACCCTCGTGATGCCGATGATGCCATTCGCT
CGATGGACGGACGTGACTTCCTCGGTGGACGGTAAGCTCCACTCTTGCTATTATAGTGTGCTTATACCTGTGAGTTTGACGTTGTTTATCTTTTTCTTCT
TTAGCATTCGCGTGGAACTCGCTCGTGGCGGAAGCCGTCGTGATGATGGTGGCCGTGGTCGTGACGCTGGTCGCGATGGCGGACGTGACCGTGATGGTGG
ACGTGGCGGCCGTGGCGACCGTGGCTTCGAGCGCAATGGTGCGTGTGTGCATCAATTACACTATTGACGTTGAAGTTGTCCCGCTGTTTACTCACTTTTG
CTTGCTTGGGGATATGTGTTGCAGGACGCAACCCTCCTCAGCGCACGGACTACCGTGTGCGCGTGTCGGACCTCCCACGCGGAACCGACTGGCGCAACAT
CAAGGACTTCCTCCGCACGGGTGGCGAAGTGACCTACTGCAACATTGAGACCGACGGCACTGCGTAAGTTATTCTTCACGCATTTTGTCACAAAGTGGTT
CTTTGTGGTATGGGGTTTGTCTGATGCGCCTCTCCCTCTCTTTCTTTGTCTTTGTGCGATGAAAAGGATCGCTGAGTTCCAGTCCAAGGACGACATGGAC
AATGCCATCAAGAAGCTGGACGACACGGAGTTCCGCGGCAACTACGTACGCATCACGGCGGAAAGCGTGGACTCGGGCGACAGACGCTCGCGCTCTCGCT
CGCCAGCTCGTGGCCGTTCGCCTCGCCGCTCGCGCTCGCGCTCCCCAGCGCAGCGCAAGGACTCCCCACGTCGCTCCCGCTCGCGATCGGCGTCCCCAGC
CGCCGCGCACTCGCCTCCTCCACGCAAGAACTCTGTCTAAGTGTCTGAAAGAAGGGAAGGAAGCAGTTGCGAGAACTAATTTGCGCCAACTAGTCATCCT
CCATGCGCGTTTCTTCTGGTTGTGTATCGACGAAGTACCGACCAAGAGGAGTGCGTGGAAACGAACAACACGATATTTTGCTTTGCTTTTGACGTACAAT
GAGTGACTCGTCTTTTTGCGGATTTCGCAGTGCAGCTTGGTGGAGTTTGTGAATGCTGCGTATCAATCGTCACGCCCCCACATCTTTCTGTCATGCAAGA
TGATCCGAACAGCGCAAGTCTTCTGTATCCAGCAAGTGCTGATAACTGCCGAAGACTTCTTCGGCTGACGCGCCACACGGAATGCGCACTTCAACAACCT
CTTTCTTTTACATGCAATGGTGCGGGCCAGTTCTTTTGCCAGCTGCAGATTAGTCTGTCAACAAGCTGCATCGAGAGATGGCTACAAAAGTGTGGACGCG
CATGCCGTCGTCGATCAAAATCAGCAGATAGATTTCCAACCAGCAGAGCAACCAAGTCAATGTACATCAAACACAACCAAAGATAACATGGAAACAGTGG
AAGAGAAATAGGAAGCAACCAAAGCGGATTCTTTCGACTTGATAAAAATCTGCAACAGCTTGGCATTCGAGGACCTCCGAGCGGAACGAAAGAGCCGCTT
GGACCGGAAGCCTTTTTACACGAGCGCCTGCCTAAAGCTGACTACCAGAGCCGAAAGAAGCGTAGAAGACCGGTCTGAATATGCCACAACAGAGTCGAAC
TTCTTAAATGTCCTTGCGCTGAAGTCCTGTGGGTTGGAAGAGAAAGAAGAAATGGGGTGGCGTCAGCATACGATGGCGATCAGTAGGTGGATATCAGATC
CTCAATGGGACGTACCAGGTGGAAGGGACTGAGTAAGCTTGTCGGCCTTCTCGGTGTCGGTCACCACCAAGGTGTACAAGTACTTGGAGCAGCGAATTTT
GAACTTGACAACCTTGTCGGACTTCTTAATCTTCACCGAGCGAGCATCTTTTCGGCGAGCCTTCTGAAGGAAGTCGCGAATGTCAGTGATTTGCTTAGGC
TGCACACAAGA