Description :
From Genome Similarity Track
Location :
Scaffold_22:744089- 745555
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008318Similar to RBOHC: Respiratory burst oxidase homolog protein C (Arabidopsis thaliana)

Sequence
1466 bases(100 bases per row)
CGAGCGGCTTGGGGCCACAGAAGAACACACCGATCTCCTCCTTCTCACCAATCGGGGTCACGCGCTCGAGGCGCTCATGGTTGTCCGCGATACGAGCAAA
CTCGCCCTTCCAGTCTGGACGTCCAAAGTGCGTCATCTGCTTGGTCGTGAGACCTGAGACGATATCGTGGCCCTCGGTGTTGTGGATGAACTTTTGAAGC
GCCTGCAGCGGCTCCACAACATTCTTGTCCTTGATCGACGAAAAGTAGTTGTGGATCTCCAAACGGTTCTCCGTGTCCATCTCGCTCAATTGGTTCATCG
TTTCCGTGAACCACGTCAGCGCCTCTTGCTCACGCGTGATCCAGTAGAAGTAGATCTTGCGGATCTGAAACGTTGGCGGGAACCGCATGTGCGAGCAACT
TGGGCAACGGAAGCTGTCCCATTGGTAAAAGATGCTGCGCAGGATCGACGCAAACGGGGTCACACCGATACCGGCGCCGACAAACACGACTTCACGGTAT
CGCGAGTAATCCTGCGCAGGCGCGCCGACAGGACCGTCGATGATGATAGTCGGGTATGGGGACATGATCGCACCACCGTGGCCCTCCATGTCGAAGTTGC
TGTTCGCCGGACTCTTCTCTTGGATTTTTTTGACGATGTTGTACAATGCGCCAGTCCAGTCACCAGCCTTGCGGATGTGCAACGAGAGGTACGGATCTTC
AGGCGCCGACGAGATCGTGAACGGGTGCCACTCGAACTGCGAGATCATTGGGATATTGATAAACATGTACATCCCCGGCTGAAACTTTTGACCCTTGCCA
AAGTTTGTGGGCTTCTTGATGAACAGCGCACAGGCCTCCTTCGAGAGTTGTGCGTTCTGAATGATTGTCCTGCCACCAAACACGTTGCCCATGCGGTAAC
GCTTTTCAATAAAGTAGATCACAATTGGAGGGGCAACCCACAAGTACGCCTCCGGTGGCGCGACCCATTGAGCGAGACCGTGGATAGCGATCAGGATGAT
GAACGGCAGGAACAGCAAGTGCGTAAGCCAGAACGCGTTGAAGTTGCCGCGACGAATCTTTGGGTGCGCGAGTGGCGCTGCGATAGCCATGAAGATGACC
ATGAGAAGTCCCGTCCAGATCGGAATCCGCTCAGAAAACTCAAACAGGTTCTCGTCGCGTACAAAACTCAGACGGTAGTACTTCGACTCGGCCCAAACTT
CGAGTGGCACCGTACGCGCGTAGTACACGATCATGATCCAAGCGACCGTGTGAGCGAGAGACGCGATGATCATCACGACACCACAGATCTTGTGGAACTC
AATGTGCTCGTCGACTGGCACAAACCTGGTGACAACCGGCAGACTACGCAGCGATGTCACAAAGTTACGGCACATGGGCAGCAGTACACATAGCGTGTTC
ACCATGATGATCTGAGCGCACCCCTTTGCGATACGCGGGCACCAACCAACAGCAGGATCGACACCG