Description :
From Genome Similarity Track
Location :
Scaffold_94:7440- 13695
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_94-abinit-gene-0.39Histone acetyltransferase
Pytiw_DAOMBR242034maker-piw_contig_94-snap-gene-0.17U11/U12 small nuclear ribonucleoprotein 35 kDa protein
Pytiw_DAOMBR242034maker-piw_contig_94-snap-gene-0.10Titin isoform N2-B

Sequence
6255 bases(100 bases per row)
CTCGTGTTGGCGTACTCCTCTCGTGACCCTGCTATCCGATAACACTCATCTTCTAATCGATGCGCCATTTCAGGAAGCTTCTGCAGCCAGTTTGGCGGTG
CGTTCGAGCCTTGATTCCGCAAAACCCGCATGATGTGGTTCAGCATCTCCTTCCGTAGCGCCTGGTCCGCAGGCGAGTGCCATGTCGCTCGTGATGCCGT
CGCAGGTGTCGCTCCAGTCGTTCCAGTCGCCTGGGTAGGTTGAGTGGGTCCGCCGTTGGAAACTGCAGGAGCAGCGGTCGTGGCGGTGGCAGTACCACCA
GCACCAGCAGAGGGACCACTAAATTGCCGTTGAACGGGTGTCGCTGTTGGGATCATCCCAGACTGGTTTGGTCGTGCCTGAGCTGACTGTTGAGCTGTTT
GAGCGTTTGCCACGGCGACAGGTGTTGGCTGCATCGCCATTTGACTCGGCTGCTGATGGACTTGCTGCCGAAGACCTTGAGATGCCGCCTGCGCTGGCTG
CTGCTGGGTCTGCAACTGCTGCTGCTGTTGTTGCTGCTGCTGCTGCAACAACGAGTTCTGCTGCTGCTGCATGGCTTGATACCGCTGCTGCTGGATCATC
CGCATGTACTGCTGCTGCTGCTGTTGCTGGAAGTAAAACTGCGCCTGTGGATTCATCATCATGTTGTGCTGCTGCATGTTGTAGTTCGGCATGAACATCT
GGTTCGCGTCGGGGACGAATCCTGCCGTCGGGTTCATGTTCATTTGCATGTTTGGGTTCATGCCCATGTTCATGCCCATGCCCATGCTGCTCATATCGAT
GCCCATGTTGTTGTTCGGCTGCTGAACACGGTTGTTGCCGTTCTGCATTCCATTGAGCATCGCAGGGTCCATCGGAATCGCGCTCAACGACTCGGTCGCC
AACGACGCTGGGAACGGGATTGCATCTGCTGACGTCGAGGACGAGGTCGACAGCGCGCCAGACAAGGATGCAGTCGTCGTCACATTGTTGCTCGCAGCAC
TCGTCGGCGAATTCAGCTCATCGGGAAAATCAATCATACCAGCCGCAGCAGAAGCCGTCGCGCCAGCAGGGCCGCCGAGCATTGACGTTGTGTCCATCAT
CATCATACCGCCGCTGAAATCGAGTCCGGAGGGGTTCAGGTCCATGGCGCCGCCACCGAGGTTGAACTGGTTCAGGTATCTGTTGTCGCTGGGGAGGCCC
AAACCAAAGTCGCCAACGAAGGAATGCGAGTCCATATTCCTGCTATACACAGAGCACAACAAATAGTGAGCATGCCATCTCCTCAAATACATTACAGATT
ACGCTAGAGCAGTTCGTATAGCTCACTCACCTTGAGTTGCCTAGAAGCTTTCGCGGTTCGCCTTGCCACGAGCTGATTATTTACAAGGAGGAATAGCACT
TGAGTTCCTCACACAGTCGTCTTCGACCACGCTCTGTTAAAACACATACCAGACGCACAGTAAGCTCTCTGCTATCAAACACAGCCAGTGGCAACACATA
CACACATCAATACATTCACTCCTCACTCGCCCAAAGCAAAGCGACCGTGGCCACAAGCACCGCGGCCGCAAGCAAGCAAAAGGTCATAGCGCAGAAACAC
ACAAGCATGTGTACACAGAGAGCGACTTACATGATCCCGCTTCTTCGCGGGCGGATCAATCAATCGCTTTGGTTTAACCGGCGTGCGTCGAAAACAAACA
AACGCACAGCGAGTGTCTCTCTCTCCTGGTTCAGTCGGTGCGCGCGCGACCCGAGCCCGCGCAGAGACGAAGGAGGCGGCTGGGACGGGCGAGGCGAAAT
GGGGCGCGGCGACGGCGACGGCGGGTCGGGCGCTGGTGCGTTGAGCTTGCAGCAGGTCAATCAATAAATACCTGCCTGCCTTCTCTTTCTCAACAGCAGA
GAGTGGGTTTCAGCAGTGCCTCCCCCCTTCGCTTTTCGCAATATCGGATATTCCATCGGATATTTGTTGGTTTTCAGTCTACTTTGGTCATTTGTAAAAC
ACAAGTAATTACATATATAGACATGGTAAATACTAGTATGTGCTTCTAATAGACAGCTGTACCCTTTTTTGCCCTTTTTCTGTAACTCTGTTTTTCCGAC
ATGTTTGGACATTCGAGAAAAGGGTACAAGAACTCACTGCAGCAACATAAACATCTTTCTTGCGATACGATCAGCAACATAAGCATGTCAAGGCATCAAA
ACACAACAGAACGATGGCGAGATTGCTTATCGTTAAGTTAAACCACCATTTAACATGGGTTGTTATATGCTAACCTAGCTGGCGGCTTGAACGGATGGTC
TCGCCCGCCAAAGCGGAGCTGCCCGGACTCCTTCCGACCGCCCAGTCCGCCGCCGACCCGCCGAGGCTTCCAGCCTGGCATTACGCGGCTGCGCTCAAAG
TCCACGAGAATTGCTCGCCCGTCGAGCTCCTGGCGGTGCGCGACGTGGTACGCGCGCGCAAAGTCGTCCTCGCGCGCAAACTCCACGAACGCGTAGCCCC
TCGACTGCTGCGTGACAACGTCGCGCACAATGCGCGTGTTCGCGAGCTTCCCGAATTGCGTAAAATACGCGACGAGCGCGTCTTCCGTGGTCGCGTAGTT
GAGCCGCCCGACGAAGAGCGTCTTGTACGGGTCGCCCGCGATTTTAGGGTCGCGCGCCGCGTCGAACTTCGCGCGTTTCGCACGCACCAGCGCTCTGTCG
TGCGGCGTCGTGTCCGTGCCGTCGATGCTGCCGACCTGGAATGGCTCGTACTCTTTCGCAAACCAATGGCGGGGGCGATGAGATGACGGCGGCGTTGCGT
GGTGGTGTCTTGCTAGTGGTGGGCTGCACTCGTCTCTATGGTGCGCATCATGTCTTGAGTCACGGCTGCGACTTCGTCGACTGGCGTATCGGTCACCTGT
GCTGCTACTGCGGCGCTTGTGGCTGCGCTCTTGCGCTCGATCTCGGTGCGCATCGTCGTGATCTCGCGCCATTTCTTTTCGAAAAATGGCGGGCTCAAAG
GTGCTTGATATAAATTGTGACTTGTCGAAAAGCCGATACAAAAGCCTATTGAAAAAACGAAATCCGTTTCTGACAAACTGAGGCACCCGCTTTTGACTAC
CCGTTTAAAGCAAGGACAAAAAAGGGCCAAAAGCAAAAAATCAACCACGGCTTTTCGTGCGCAGAGTTGCATCAGCAATAATGGCGGCGGCGAGGAGCTC
CATGGTGCTCCGCGTCTGTATCGTGGTGTGGATGGCGCTGTGGCATCACGCGTACGGATTCCGTATCTTAAACTCCAGCAGTGAGCTCGCGAGCGCGCCC
GCCGCGGTATTTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCGGGTACTTTGGCGACCCGGCGA
ACCCCGACCCGGAGCGCGTGAACGAGGGCGCGCCGTTCTCGCCTGACACGCCGCGCGTCTACTTTGGCGGCAACCTCAAGCGTACGCGCTTCTATACTAT
GTTTACTATGTTGTAATGGGCTGCTGATGGCTACACACTTGTGACTGCAGAGAACTGTCCCGGGATGGTCGGCCCGATCAACGACGAGGAGTACTACTGC
CGCGGCCGCGACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCTCTGCGTGTGTAACCAGGGGTACACGGGCACTGACTGCACGCAGTGCAAGCCATCGTACTTCAACAGCGGCGGGCTCTGTTATCCAAAGAGTA
TCTATCGTAGCGCAATCTGTCTACAGCGTGTCACTGTGGAGCTGCTCTTACTAATCTGTTTAAGTATCCTGCTTATCTAATAGAGAGCTGTCCGAACGAC
TGCTCACAAGGCGGCTCATGCGACTACGCGACGGGCAAATGCGCGTGCGTTGCGAGCCGCAAGGGCGCCGACTGCAGCCAGGTGTTCTGCCAATTCGACC
CGCTCTGCACGAGCTGCACGAGCTCCTCCTGTCTCAGCTGCGTCGAGGGCTTCTTCGTCAACCCAGTGACCCAAACATGCGGTGCGTGTGCGTCTTATAA
ACTTACACTCACCCCAACCAACCACTCATTTTTGATGCGCTAGTGTCCTGTAAGAAGTACGATCCTCGATGCCTGGTCTGTGACGCGCAGTCGTGTCTCG
AGTGCGCCGACCTGCTGCTCAACTCTGTGCGGCGCAGTGGGGCGCGAGCACTCGATGCCTCACTTCCCTTTGACGAACTCACGCGTGAGTTCTCGTTCAA
GTTCTCGTACGGGAGTCAGCTTCCGCGCGTGTTTGATGAGGCCGAATCTTTCTTCCTGACGCCACGCACCAGCACCGCTTTCCTCAACGAGTCCAGCAAG
ACGTGCTCCCAGGGTCTGAATGGTGACGCCTCATGGTCCTGCAAGCCATTTGCTGTCAGCCATTGCGTGTGTGGCCACAACGGCGTCTTCTCATTCGGAT
CCCCGGTCTACGCGATCGCAGAATCGGCCAAGAGCATCACGCTGACTGTACAGCGCAGCGGTGGGGGCCTGGGCTCTGCCACTATGAACTACGACGTCCA
GTACCTCACCGCGTCCCCTAGCGACGTATCACCCACGGCGTTCTATACGAGTTCGCAGCTGCTCGTCTTTGACGAAGGCGTCGTGGAGCTCGCGTTCCAG
CTCACGATCCACGACGACCATGTCGTGGAGCCAGATGAGACGTTCCGCGTGACGCTCAGGAACCCAGAGCTGGAGACGACAGCGAGCCTGGGCAACCAAC
GCCAGGCGCTCGTGACGATCCTGGACGACGACGTGGCGTTCGCTGACGCTGGCTTATCGTACGTGGTCGATGCGGACAACACACTCAAGCAGGGTGGGCG
AGCGGGATCCGACCTGATGTTCAAGATCCAGAGCGTCCTGGGCAACGGCGCAGTCAAGACTGTCGGTGCTGGTGGTGATATCTTTTTGATGGAGTCGTAC
ATGGCAGACATTGAGGACGATCTTGAGGAGTATGCGTCCTATGAAGTGTATCGCTCCAAGCAGCTTGGAAGGATCGTCGACAATGCCGACAGTACGTACA
CGTGTACGTGGCAGCGCAAGCACACAGGGAACTTCACTGTCACGATCTATCTGCTATACCCCGGTGGGCTTCGTGGCGACTACTACGACGACGCGTGGCT
TGGAGACAATGGTCAAATACCGCCAGCGATCACGCGCATCGATCGCCAGATCAACTTCTCGTGGGGCAATGGTCCGCTCTTTCCTGGGACTTGTGACTAC
GTCTCAGTGCGCTGGAGTGGCAGGATCAAGCCAAAGAACACGGAGGACGTGACTTTTTACGTGACTGCAGATGACCAGAGCCGCCTCTGGATTGGCGACT
TCCTGCTCATCGACAAGTGGGACGACACGTCCACGCCAGGTGGCCAGGCGAGCGCGACGATCTCTCTAGACAGCTCGCTGTACTACGCGATCGTGCTCGA
CTACCGGGAGTTGGCTGGGAACGCCCAGGTGAGTCTCTGCTGGAGCAGTGCGAGTCTCACCAAGGAGGTCATCCCAGCCGCGAGTCTGTTTTCTGTCCAA
CACATCAGCGGCAGTCCGTTTCAGAACGTGACGATCGCGCCAGTGAACACTGCGAACGTGTTCACGAGTACGATCCAAGGCGTGTTGAGCTCCGTCGCTG
GTAGACCACACAGCGTAGAGATCTATCCAATGGATTTGTATGGGAACCCGCGACGCGTTCAGAACGACTCGACGGATCTCTTTGAAGCCCGGATGACGCT
CACAATTGACCAGAGTCTCGGTGGCATTGGCAGCAGACAGAACGACGCACTCATCGTCTGGAAGCCAGTACGCGAGGCCTTCAGAGTGTCGTTCACACCA
CTTATTAGTGGGGTCTACGACCTCGACGTCTGGATCAACACTGTAAAGCTCGGTGGGAGTCCGTTCACGATAGTCGTCAAGCCTGGACTGATGCACGCAA
CGAGGTCAGTGATATCAGGTGCTGGCCTGCTGGCCAACCGCGTCGCTGGTATCGC