Description :
From Genome Similarity Track
Location :
Scaffold_2111:744- 3108
Sequence
2364 bases(100 bases per row)
CTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGA
TCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCC
ATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTG
ATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGG
GAAGAGGCGTCGTCGGAGGTCGGATCGACGAGGACGCTGCTGAATGAAACAAGATCCGCGAAACGATGGAGTTTTGGGAGGAACTCTGTCGACGGAGAGA
GGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCTTCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGGAACCAAGATCTTCTGATCT
TCAAGGAAAAGTTCTCGCGAATCGGCTTGCATTTGCTGATTCACCGGTTAAGCCCACATTGTCCCTAAACCCAACCTCGCTAGTCGAAGAAACGAGAAAG
AAGACGATAACCAGTAAGACTATCCGGTTCATTATGGTCGCTCCAGAGTCGGAAGTCGAGCAAGTTGGATCCAGGTCAGGCTGGTCAGACAAGGATCTCG
AGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGAGAGCCGGT
GAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTATGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAG
GATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGAACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAGAGGTCGCGCACTATGGATC
CGGTGTCGTCGCCGAAGGTCAGACTAAGCTGCATCCTCGAACTACGAATCCCGCCGCTGAGGATGAGTCAGACACGTCGTCCCGGAACCACGACGCGTGA
CTTTAGGACCTCCGGGGCATCCATGTTGGAAGCGCGGGCGAGGATCCGGGGACAGGAAGTTCCTTTGAACGTGAAGACTCGGGATCCCAGTACGCCCTAC
CCGTAATCTGACACAATCCAGCCAGGATCGAGCCAGATCCCGGCAAGAAGCCAGTGCGATTATCGTCAGATCAGGCTCGATGTAATCGCCTCACGGACCC
TTTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTCGAAGCTGCGATGAGTCGTTTTCTGGCCGAA
CAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAAATGGAGTCAGTTGAGGAAGACAACTCCCATGATG
AGTTCGACCCAGATGATCTGGATAGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGAGGATCGTCCATGATCCAGAGGGTACG
GATCTCAGCCATATCGGACCTGAAGGAGTTCACGGGCAAGGATTGAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGA
GATCAGGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAAGTGGTATCGGCAGGCTGGGGCAGATCCACCAGGAA
CAAGTAGCCAGATTTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGA
ATCCCCGCTAGAAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGAA
TCATTTCATCGAGACGGTGAGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTG
GATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTC