Description :
From Genome Similarity Track
Location :
Scaffold_70:7439- 10475
Transcript NameFunction/comments
Phyag_g1549lysosomal alpha-mannosidase, putative

Sequence
3036 bases(100 bases per row)
CACCCTTCGCGAAACACAAGCGGAATGCACGCACTTCGATCGCTTGCAGTGTCACCGACGTGCCCTTCGCAGGCAACGACTCAGGAGACCAACCGTACGT
GTcgtccgtcgtcttccactCCTTGGCGGCTCCTTCTTGCTTCGACAACTCCTTCGTACCAGTCAGCACCaactccgtcacctccgacaccttcgagttc
ttcaccgAGAACAACGCATTGAAGTCCACCGTGGCAGGTTGTGATAACGTCGCGTGCTCCTCCACCGCGTACAAGTGCGACAGACGCACTAACAGGCACT
GCTTCgacagctcctgcagcgtcgtcagaCCCACGTTCGGAGGGAACTCATTCACCGTTAGCCACGGCACCTTCGCCTTCACCTCGGACGAAACAGGCTT
GCGGTAGACTGTCAGCGGACGGAAGAACTGCGACTCCATCTTGGAGCGGATGCTGCGCATGCCATCGTCGGCCGAGTCCACGTTGATAAAGAAGTTGCCA
CGCACCACCAGACCCTTCGTCACGTACGTCTTCGTTGCTGAATCGTACACGGACTCCGTCTCGTTCAGGTGTTCGCCCACGCCCTTGCTATCATCGGCAA
GCAAGCGACGGTGAATCATCACCTCCAACTGTCCGTCTACTAAACTTGCTGCTCCCTGCGCACGGTCAGTCACCACATTCAGTTGGCGCTTCGCGTCCTT
GATGTACGCACCGGTGGTGATAGGGAAGTAGTTAGCTGACACCCCTTCCTGGTTGTCATGCAATTTAAGGTCCCACGTATCACGATGGTTGCGAACACGC
TTCATGAACTCGAGGCCGTTCGAGTCCGTGTACACAATACCGTCGGACGCGATGTCTTTTCCAGTGTCAAAGCGCACGATCACCTCCTTGCCCTTCTTAT
CATCGATCGGGACCGGTCCAACCGTCCACTCGATCTCCAAGaattcgtcatcgtcgttcACGCGGTACTCGAGTGTGACCCAATTTCCGACCTTGAACGC
CACACGAGGCACGCTCATGCGGCCACTGTTAGAGACGCTGTTTgtttgcagctccaccatcttcacATTCGACACAAAGTTCGACGCAGCGTTATCCTGA
CCATTGCCAGTCACAGGGTACGTCTTGTTCGAGTCGGGACGGAAGGCGTATGCGCCAGATTTCGGGCCGTCGCCTTGGAACGCTTGGTAGTACGCAACGT
CCAAGGACAACGGGATTTGaatgttcttcttcttgttggccagcTTCGTGATGGATCCCGTCGTCTTGCTGATCTCTGCACGCAGCAAATGattctccag
cacgacgacgtcttcgttCTCCTCAAGCTTGATGCTGCGGTCAATGATGGCATCGTCATATGAATCCTTTTGCTTGACCAAGAAGCGGGTTGTGCTCAAC
GGCTTCAACTCCGCGCTGAACACGAACGAGTGCGGTGCTACCTGCGTCTCAGGGTGTACCGGTAGAGCTACGTACACGTCTTGGCCACGCACTTTTCCAT
CACccgacagcaccgtcacctcgGCCGACTTGTGGGTGATCGGAATCGAGATCGTCTGCACAGTTGTTCGGGCTAGAGCGTTGTGCACTAACACCTCGAA
GTCGGTGTTCTGTGTGGAGACTTCGCACACACTCGTGTTGGCCAACAAACAGAAGTGGTAAGGCTCCTTCTCTCCGATGACGAACAGCACCTCattcagc
tccttctcggcctGAATGATACCGTCATTCATTCGCAGCGCATAGTCATCAGCAACGCTCTGCTTTTCTGTACCGGAGAGaccgtcgtggtgctgcacaa
gacCGACGGCGCGTCGCAGTGCAACGAGCGGACTGGAGTGGTGGCTCTGGTAAATGGCATCTATTTGCCtgacttgctgcagcacagtGTTGGCCACCTG
GGCAaagcgcttcaacgtcgGTCGACTTGTGAAGAAGCCCGACCAATAGTCGTCTTGAGCCGAAGCGTACGGGAAGAAGTCGTCGGTCTTGACACTCCAC
GTCAAACCCTCTGCATGCTTCACGTCCGTGTAGTACGACAAGTTGGAGTACAGCACATTGACCCGTCCGTCCTGGTTCACGTAATGAATGATTTTGTCCA
TGTTCTTGAACCACCGCAGCGAGTTGTCGTACTGGAAGTCACAGCCCATGGGAATGAAAACATGATTGCCCTTCGACGCCCCACCACGCATCTGGGCGTT
GTTCACAAACTGTTCCACTTCATCACACACATCATAGTCATGGAGGTCAGGATCATCTTGGATCTGGTTGCCATTGTTGCCAAAGTCGAACTTCCCCGGT
GGACAGTAGTGGTCAATGATCTCTCCAGTGAACACCTGCGACGCCTTGCCGCGAGACTTGCTCGGACGCCAGATGAACTCCAGATCCTTGTGTCTCTTCC
GATTCCCATAGTCCTGGTAGTCGATGCGTGCGAAATACAGCGCATCAAAGCCCACTCCTTGAGACAACAAGGACCCCTGCGTGGCCGAGTGACCGAACGG
GTCGATCTGCCACCCGATGCGCGGACTGAtgccgaactcgtccatgagcAGCTGGTGGCCGTACGCCGTCTGGTCCACCATGGCGATGTAGTGCGGCGTG
GCCTCGTCGTGCATGCACCAGCCTCCGTTGACGGTGAGATCCAGGCGTCCCTCCttcacgagctgcttgacgatGCCACGCACCTCGGAGCCCTGCTGGT
GCCACCAACGCTGGAAGAACGACTGCTCCACAAACATGAACTGGCGGTCCGGATTGcgcacgagctcctccacggcCGTGTCCAGGATGTACTGCACCCT
TTCGACGTAGTACTGGTCCACCCCCACGAGCCATCCCCTGCCAATGTGCAATTGCAATACACAACAATAGGTCAGTATGAGTTGCAACACACACATTGCA
AGCAATATGTAGATCGCAGAGCGTACGGGTCATCGTGGGAGTGTGCAATGAGATGCACATTGAGCTTGTTGGGGTCGACTCGACTGGTGGTGTTGTAGAC
ACCATCGGTGGGGGGCGTCCACTTACTGGGGTCgca