Description :
From Genome Similarity Track
Location :
Scaffold_8:7439- 8901
Transcript NameFunction/comments
Physo_288677Mitochondrial Carrier (MC) Family

Sequence
1462 bases(100 bases per row)
CACGTCCTGCAGTCGAAGCTGGGCATCTCCAAGCAGCTTCTGGAGTCCACGAGGATGGAGGAGCTGGACAGCTACGTGCGCTTCCTACTGGAGACGACGC
AGGGCCTGCTGGGCGACGAGGACGAGGACGACGAGGACTCGCCCGAGTGGGACGGCAACGACAGCTCGAGGTGTCTGCCGCTGGACCTGATCAGGGAGTT
CTTGATGGTGAACGAAGACCACGCGGCGGCGGAGGATGCCGCCAAGGCCCAGCAGCAGGACCCAGAGACCTCCAAGGACCGGAGTGCGGCGAGTGCAGTG
GCGCCCGCAGTGCCGAGACGCCAGCTGCACCGCCTCACGAGACGCAGCTCGTCCGTGACCAGCTTCCACGTGCGAGAGCTGGACCTCGTGGAGAAGAAGA
GCTCGCCCACGGGCGACTCGATGCGCAACCTGTTCGCCGAGGACTGGTGGGACCCCACGTTCGCCGACGTCTTCGACGAGTGCGCGGCGCCGCCCGAGGA
CGCCTTCATCCACCGCCAGGTCGAGGACGCCCCCACGCGCACGCACCCGCTGCGCCTCATCGAGAGCTTCCCCCGCCGCTGAGAGAACAGGGGAGAACGA
CGCCACAGGCGGTCCGCAGCGCGAGCAACGGAACGAGACAAAAGGGCCGCCCCACTTTTCGATCGACAGTGCACGGCGCTGCCGCTGATTTATTTGTAAA
AAATTCGCTATCTAACGCTAAAGAAATTATCAGCCCCCACAAAGTTCGAGCCCTGCAGTCTTCAGCCGGCGACCGCCAGCGACAGCTCGGTGCTCACCGC
TATGACCAAGACCTCGCGCCATTTATTTTAAAAAATACTCCAGAGAAGAGAAGCTGACGCCAAGCGAAGAACCGCCGCCAGACGATCTTTCCCCATCTCG
CGGGAACCAACGCAAGTCGCTGCGGTTCAAGCACGTACCGGTAGTTGGCGGGAGCATCCTCCTCGTCTCGCATGGCGAGCAGTGCTAACGCTGCTAATGC
ATCAGCTTGCGCGCTGGGAAGCGATCGTAGATTGGCGAGGCGAGTGACGGCCTACATGTAAGCAAGCAGCAATGAACGCAGCGCGTGTGTTCACATCCTG
CTTGTCCTTCCCGCCAGTCGCGCGCCGATTAAGATTAATAGAAACTGCAGGAACATTTGGAAACGGCTTCAACAAGTCGTAATTTTCAGACCGTAAATTG
TACGGTGAAGTGACCTCGCCATCGACAGTCGATTCGACTCACCCAAGAAGACCTGGGGCGAGAGAGAGCTCGGTCGGCGTACAGAGTGGAACGGAGAAGG
ATTTGGGCCGCTTCGGGAGTACCAACCTGATGCTGCATGCGACCAGGCTCGACGGCAAGTATACCTGTGAGGTAAGACTGTTTTGCCGCCGGGTACGGGA
ACGAAGAAAATGTGCTTACCAGGAAAACAATCGTCCCTTCAGGGTTAATCAAGAGTTCACTG