Description :
From Genome Similarity Track
Location :
Scaffold_157:74389- 78287
Sequence
3898 bases(100 bases per row)
TCCTACTCCTCTTCGTGAGTCTGCATCATGCCAAATCGATTCCGATTCGTACGATCCCGCAAGAAGTCGTAGCATAATGTTTCATAGTTCAGATCTGCCT
CTTCTACCCAGCTGGGTTCGTCATATCCACCACCAATACACCAGAAATTTGGGTGTAGAGTGTGTCACATATGTGGTTCGTTTTCCTGATCTCATGTCGG
CGATCCTCTCGACTTCGAACTCGTCTGCTTCCAGATCCACGCTCCAACTATTTTCCGGTAGAAGAACCTCGTCAAAATCCACTCGGTTGGACCCTTTCAC
TGAAAGATGGATCTTAGGCCGGTCCGGATATTCTCTAACCAGGTTTAGCTTGGATATGTGTACTACAGGGAACAAGCGATATTCGGTGCCCGCCGTCTCC
AAATTCACGGCGTATTCCCCTACCTTTCCCTTACTCGGAGCGGCCCGTGCCAGAGATGGGCCAGTTTACGGGCATATCCTTCTTTTACCCGATCCTAGTA
CAGCCACACTTGCGATTCAACCTGGATTTGATGTGGACGGGCGTCTTCGTTGTGCCGTTCCGCTCGATCCTGTATCGCACTTCGAAACCGTTCGTTCACT
GGGATCGGGCTTGCTGGTAGTATTTCTGGCCTTAGTATCGCCATCGTCTTGTGTCTCGGTTTCTCCTCTTGGTACTGCCCACTGGAATGGCCGCTTCAAA
AATGGATCTAGGATCCCATCCATGTACCAAGTAGAACGGGGTATCGCGCTGTGGATCCTGTCCTGTGTGGTATTCATTGCGAAGGTGAGTCGCGCTGCGT
ACTCATCCCAGTCCCGCTGATCCAAATCCTGGACATACATCTTGAGCGCCCATGTGAACGTCTGAACCATGCGTTCGGCAGATCCATTGGCTTGAGGACG
GCGTGCCATAGTTGCCCATTGTCTATGCACAAGGATCCTGTTGAAGGCTCGAAAGAAATCGGACATGAAACCTGGCTCCCAATCATGACGAATCATCTCA
CTGGCTCCGAATCTGCGAAAGACACATTCCTCGTAAGATTCGGCGATGGTTTGTGCTGTTCTGGACGCGCTAGCCTTGGCTATCACGTATGCGGTGAACA
GATCCACCCACACCAACAACTGGGTGTCCCCCTTGGATGACTTGGGTAGCGAGGGAATGTGATCCATCGCTATGTTTTGGAACGGGTAAGTCGCTTGGAT
GCTACCTGGAGACTCCCCTTCGATGGAGGGCCTGCATTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGCACACTCTTGAATAGTTCTCTC
CAGTGGAAACATTCTCGAATCCGTTGGTAAGTCCGGCCGATTCCCTGATGTCCTCCTTCTAAGCTAGCATGATAGTGATTTAGGACATCCTGTTGCAAGG
TTTCCGGCATCACCAATCTCATCAATCCGTCTCGATCGCCACTGACTCGTTTCGTAAGGGGGCAATAGATGTGCAAATCGTTCCGATCCACTGCATAATC
CGTAGCAATAATACTATAGGATATTGCGTCTTCCCGACTCAAGTCCCGTACATCTCCCATCAGATACTTCTTTAATCCCAAGATCCATGTTTCGTCGTTT
TGTGCTTTGAGAATCCGCTCAATACGGACTCTCTTTACATACGCTTCATCGAAATTCTGAGGGCTAGATCTAACACTTTCCCTGGATCTAGTGACAGGCG
TAGCCTGTACCATCCGCTTCACGGATCTAACCATGACCACTTCATCTAGGCGGTTCAATGTGACGAGATCCTGGCGCTCTACCTCTCTCTCCACTTCGAC
CCCACATTGATTCCGTAGAGAGGCACTTGCCAAGCTGTCCGCACTTGCATTCCAATCTTGCTTGACATGTACCAGCTCATGATTCATCCAACCACGCAGG
TGCGTCATCACCATCTGATGTAACAACGTTAATGCAGGGGCCTTGCGGTCGATTTCACCTCGCACCTGTCTGATTACCAAATGTGGGTCTCCACATATCA
CCAACCTTTTCGGGTCCTCACCTTTTAGTAGATCCAACCCCAACAGGAGTCCGTTATATTCCGCTTCATGAACGGTAAGGCCTTCCTCGTACGTGGATCT
GGCCCGTACCACTTCCCATTCGGGCAGTCTCCATAGGATTGCGCTGTAAGCTCTTCCTCCCGTCGCACGCGAGCAGATCTATCGAAACTCAGAACGTATA
GATCTTCCTCCACTTGCACCGTCGGGATCGGGATCTGAGTCTGGCGTCTGGGCTCTTTCTTATAAGCAATCCTAGTCAGTGCTTCGTCCATCTTGGCTCT
GGGCGTAATGCTCGCGGCCAAAACACCTAGGATCTCGTCTTCTCCTTTCGAACATCTAACGACCTCCAGTGTCCATGGTGAGAGCAGGGCTGCCCATTGT
CCTTGCAGCCTGGCCGCCTTAAACAGCCAGGCAAGCGTGGCACGTCGAGTCAAGATCTGGATGGATCTCCCCACCAGCAGGATATAATTGAGATCCAACA
CCCGTAGAAGTGCCAGTATCGCCTTCACCACTGCTCTGTAATTCAGCTCGTTCGGCTTTACTGACGAAGGTGACCGGATGGTAGATCTCCTCATGTTCTT
GTACCAAAGCTGGCGAGACCGCCCAATCACTAGCATAGACTATCACCGTAGGTTGACGTTCCGGATCAAAATGGCGGAGGATGGGCGTCGCCGCGATCCT
ATTCCTTAGCTCCACGAACGCGTGCTGAGCTCGGATCCACCGAGGCTCCACCTTTTCCGAGCTCCCCTCCGTCAACTCTGTCCAGATTGGATCCTCTCCC
AGTTGGTCCCGGGATAGATCCAGTTCCTGTTTTAGGTCGTCTTCCGGCGTCGTACTATGTGGACCCCCTCGTGGATCTGGGATCTCTAGGGCCAGAGCTT
GTTGGATCTTGATCCAGCAGCCGAAGTGGCCATCGCAGCAAAATCCACCTCCCTCAATTCATAGAGTACTGCAGCAAACAGTGCGTAATCCTCGATGAAC
CGACTGTAGTAATTCAAACTGCCCAAGAAGGATCGCAGCGACTGCGGGAAAGACAAATCGGCCAACGAAGACAGATCTTTAGGATTCGCCTCCAATCCCT
CTTTGGAGACTCGGTGACTCAAATAATCCACCTTCGCATTCCCCAATAACTCTTCAACACGCTGATAGAGAGATTCCACTTATTACACGCCTCCAGTAGG
GATGTTAGTCTCTCGCATAGCTGATCCCACGATTCCGCCGGGATTAGAAAGTCGTCGGTATAGGATCCGCGCCCTAACACGGATGGTGTCCTCAGATCGC
CTGACACTCCTGCTTCGAATAGATCTACTTCCGCATCACCCTCTCCGAATCCACACCCTTCGGGCTCCGGTATTCGAATAAATCCGTAGAGGGCATTATC
AATCAGACGTTGTTAGATCTGAGGTGCATTCTTCAATCCAAACGGCATCCGGTTCCATTCGAACAGTCCAAATGGTGTAATGAATGCGGATATTGCGCGA
GTCCGATACGTCATAGTCACCACCCAAAATCCACTCACCATATCTAGGGAGCAGTACTAGAGTACTTTATCCGAATCTTCCAATAGCTCACTGATTAGAG
GCATCGGATACACCATCGGTCTGGTCAGACCGTTAACCATTCTGTAATCAATTCACAGGCGTATACACCCCGTTCTTCTTAATAATGATCACCACAGGAG
ACGCCCACGGGGAGGTTGAGAAACTGATGATTCTGGCTTGCAACAGACCTTTAATCAGATCCGAGAGCCTTTCTCAGAGCTGAGGTGCCACCTTCTGCAC
CCTTTGAGCGATCGGCTTCGGATCCACCTGGATATCGTCGATCATGACTTCCTCTGTGGTCAATGGCACCTTTGGGATTACCGCGATACCTTCCCCAA