Description :
From Genome Similarity Track
Location :
Scaffold_37:74387- 77059
Transcript NameFunction/comments
Hyaar_Emoy2805269hypothetical protein

Sequence
2672 bases(100 bases per row)
TATGGATTAAGCAAGCCAACGCAAAACGCTGGGTGTGTGCGCAACTTGCGCGGGAGATTGAGTGTATTGGCAAGGCCTTTCTTCGCTATGATAGTAAACG
GCCCAATGAAGCGCGGACGCAATTTTGTCTTGAAGACGGCAGACACTACATGAGTAGGTAGGTTTTCAGCAATCAATAAGACTTGGTCTCCAACTTCATA
ATAATCAATACATCCTCTGCCTATAGCATCAGCTTGTTCTTTTTGTTTGTCTTGGCTATCAGCCATTGCATCACGCACATGTCGTAAGACACTAAAGCGC
GTAGCGAGGAACTCGCCCACTTGTTTCCGCATCGTGGTAGGGCTGATTTCAGCAAGCTTGTCAGCAGACTCTCCCCACCAAGCCCAGAACCACTTAGTGG
TAACGTAAGCGAAACGCGGGGGTGCGTGAGGCAATTCACATAGAAGGTAGTAATGCCGGTCGAGATATGAACAGCGCTGTTCAACACAAACTCAATGACA
GGGAGCATCGAGCTCCAAATCTTAGGCGACTCAGCACAAATACTGAGAAGGAAGTCGCCAATGATACGATTAATTCGCTCAGTCTGACCATCAGCTGTGG
ATGATCCACTATAGACATGTCCAATCGCGTGCCAAGCACCTTGAAGATGGAAGTCCAAACTTGCCTGTGAATCGAGGGTCGCGATCAGAGATGATTGCTA
GTGGCAACCCGTGTTGAAGAAACACACGATCGATAAACAGCATAGCTGTACCTTTGCTATCGATGGAATCCAGCACTGCCACTAAGTGATCCATTTTGCT
TAAACGGTCGACAAAGACCACAATCCCCGTATTGCCGTCACAGTCGTTGGGAAGACCAAACATAAAATACGTGCTGATGGAATCCCAACACCTCGTGGGC
ACAGGTAAACTGGCGATTGACGCAGCCGAATGTGCTGATGGTTTGACCCGCTGGCACGTTTCGTAGTACGCACGTATGTGCTCACCCATTTGTAGAGTTT
GGGCCACCAGTAGTGTTGACTCACAGATCCATAAGCCTCTTTCCGGCCCAAATGACCACTGAGGTCATTATCATGGGGCTCAAAGAGGATTCTTACATTT
GAGATCCTCATTATGAGGCACAACAATGTGAACGGTACCGCTACATCAGTGCGATAGCAAAAGAGACCATTATCGATGGAATATCGATGTATGCTGGCCC
GCAAGCGTGCCGATAATTGACTGTCCGAGTCCTTGTATTCCTCACTCTGGAGGGCATGAAACAATGCCACACACTGAGAGGTCCGTGGATATACCACACG
AATTAACTCCTCAATAGGAGAATAAAAATCATGACATGAGCAAGCTCATAATCAGGTCTGCGAGAGAGAGCATCTGCCAACATACTTTGTTTGCCTGGCT
TATACTTCACCTCGAAGTTACATTCCACAAAAAAGGAAAGCCACCGAGCCATTCTCTGAAAGAGGTGCGGCGACTGTGCCGCCGTGCGTAATGACGCATG
ATCCGTATAGACTACGAATGGCTAGGGGTCAAGCATATGGACTCTAAATTTGACGAGCGCATACTCCATAGCAAGTAGCTCTTTGTCATAAACTGGATAG
TTCATTTCAGCAGATTTCAGCTGACGAGATTCAAATGCGTTAACTCGATCGCAGCCTGCAGAATCTGATTGTAACATACCGCTGCTATATAGCAAAGTCA
GATGCATCGCAGACAACACTAAAAGGGTACTCAGGATTTGGCAACGCCAGAATGGGAGCATGGAGGATATTATCCTTATTGCCGGAAATGCGTCAGCATG
GGTGTTGTTCCAGCGCCAATCTGTGTCCTTCTTAAGGCCATCAGTTAATGGCTGAGACATATCAGCGTATTTTCACTGTATTTGTGTGTAAGTAATTGTC
AAGGCCAAGCCACTTACGCAAGTCCTTTTGATTCTTAGAAATCGGCCAGTCCACTATAGCCTTGTCCTTCGCGGGATCCGCTCTAAGGCCGCGCTCACCA
ATGAAACATCCTTTAAAGGAATCTCCTCTGCACCAAAAATGCATTTATACGCGTTGGCATACAATTTATTAGTGCGCATGCACTCGAGAACGGCTCGCGA
ATGACCGATGTGGTTGTCAACATCTAATCGACCTTGTTCGGCACGACTATGGACAAATAATATCATTAAAGTAAGTCTGTGCGTCGTCCCGATGTGCGAA
AAAGTTGAGTCACCAGACGGTTAATTCTATCTGGAGCATTAGACAACCCTTGGGGCATCACTAGCCATTCCCATAGCATACCACTCGGAAAGCTCACTGC
TGTAAGCGGGATATCACTCGCTCGCATGAGCAATTGGTAGTATACATCGACTAAGTCGAGTGCACTATATATAGTACAAACAACCATGTTTTTTTGGGGA
ACATCCTTTCGAGGAATGGGTGTCTGTGCCATAATAGTGGCCGCATGAAGCTTGTTGTAAGAATGTACAATACGCAACTTGAAGTTCGGCTTTTTGACAC
AAAATGTCAGTGTCGAATGTGGAGATTTACTCTCACGTACCATTCCTGCCTCGTGCTTGGCACGGAAGATGTCATCAATGACATCTCATTGCTTCTTAGG
CAAGGGCCACTATCGTGTGACACAGTAATTAGTCCCAGAAGCTAATTCAATTTCATGACGGACAACTCTATC