Description :
From Genome Similarity Track
Location :
Scaffold_74:74382- 78213
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17720hypothetical protein

Sequence
3831 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCCAGCGACAGTACCAGCAGGCACGCAAGCTAGTCAACGAGGCGCTGCACGCCGCGATCGAAGGAAGA
GCAGATCAGCACAACGAAGATGCGAGTTCGCATGACATAAAAGCAGGAGATCAAGTATGGCTATATTTAGATCGAGTTAAGGAAAGTTATGCTCGCAAGC
TTGCGCATATGTGGCATCGACCTTTCAGAGTCACGGGGACAGTCGATCGACACGCAGTGTGTTTGGAGACACCCTGCACAGCGTACAGACTATTTCCAAT
CGTCCATGTGTCAAAGCGGAAGCTGGTGAAGAGTTACCCAGAGCGCCCAACATCCACGCAGACGAACCGCGAAGCAAATCGCGTAGACTTCGACGAAGGC
TTGCTGCCCGAAGACAGCTGGGAACGCGAGCTTGAAGAGGATTAGTACGAGGTGGAACGGATTGCAGGTGTGCGCTCGAGCAAGAAGACTCGATACGAGC
GTACACGACGTGAATACCTGGTTTTCTGGAAGAGCCGTCATGGGTCGATGAGCCTGATCTCAACTCTGGTGCGTTGCTAAGAGACTTCGACCGGGGACAA
CCAGATCGCAACCGGTTTGAGGTGATGCAGTCGCATCAGCAGTAAATGGTGGAACATCTGCGGTGGGTTGTCCACCGTGGAGAAGTGAGAGGAAGAAGGA
TCTGCAGGAAGGCTGCAGATTTCAAGGAGTAGGTGGTGCATATGACGTACCGTGGGCCTGAATAGGCCGGAAAAGCTAGGCAATACACCCTAAAAAATCC
CGGAAGAATGCATGGATTAAGTCGGGTTAGATCGGACGGGACCTACTTGACGAGCGCTAAAACCTACAAGTTGCTAGCCAACACAAAACGGCAGGACCCG
ATCAGGAAGAGGAGGACACGAACTTGCCAGGCAAACGAGCGATCTCAAGCGCTGGATGGTTTCCTGGCACGTCTCGATAGTGGTTGCGCCAGCGATCAGC
CGCATCCGTAATGGCCAACGCCTCCAGTAGATCTGCGGGATCGGCTCCGCCGTCAATTCCAGGGTACCAAGCCTCTGCTTCGCCAGGTCGAGGGAATTGC
AGAAAGAAGGGATCCAGCAACAAGTCGAGGTCGCAGTAACCCCGGAGCAAGCTGATCGAAGGAACGATTTCTACGGGGCACCGGTCCTGGATCGATGCTG
CTTGCGATCAGTATAGCACGCCTTCAAGTACCGATTCGCGCGACGCTTGGCGATGCTCACCGGAAAGGCGTGAGTGTACAGTCGCATCATGTGTCGAAAC
CAACCTCGATCCTGAAACGCGAGAGGATCAATCTTGGCAGCAAGGATCTCCCACGGGGCAGACTCGATCAAGCCGCGTACGTTGCTCTCGTCCATCAGAT
CGTCTCGCCATTCTCCAAGCGGAGGCACGGAGTCGTGAAGACGAATGAGCCACTCCATCGGTTTGGCGAAGTAATGAAATAGCAGACCCGCGTCCATCTC
CGCTATACTTGTCTGACGAATATCCTGCGCAGACCAGGGGACGAAATCATGACTGCGGAAGCTACGACGGTCACGATAACCGGGGAGCCACTCCGATCGG
GGAGCCGTGGTAGGCACTAGATTCGCCAGCT