Description :
From Genome Similarity Track
Location :
Scaffold_424:7438- 10534
Sequence
3096 bases(100 bases per row)
CCAGTTGAATTCTGGCTTCGTCCGGCAAAGAAAACTGTCCCGTCCGCCAGGTCAAGGCGTATTCCGGCCGGTACCATGAAATCCATTCCTAGAATTACTT
CTTGTACCACTTGGTCACCGACCCATACATCAAAGTAGTAGACTACTAGTGACCCATTCAGCGTGATCTTCACTTTCGTGCGGCCTTCAGCCATGTATGA
ATTCTCTCCAATACCCATACATTCTTTCTTCTGACTCTCGTCTATGACACAGCAAACCTTACGAGCAAAGGTGGCGTCGATGATTGAGACTTCAGCTCCC
GAGTCAAACAGTAGGGCGGCCTTCTCATTGTTGATTTCCCCCCTGCCTTCGTTCGCCTAAACCACTTGTTTGGAGTATGATACTTCCAGTAACCACGTGA
TTCGCCAGGAGACAACTTGAGCTCCATCTTTGTGGGTGATCGTGCGTATTCGTCCGGTCGCCGCAGACTTGCAATTGAAGGAAACAACTAGAATCCAAAA
CACATGTACTGAAATTCCGGCCGGTCAGGTGATTAACACTGTTATCAACCCCATCTCTCTCAATGAAGCATATATGCATAGTCTAGAACGCTCGGCTCGT
ACCAGGTTCCAACCTGGCGAGCGTCCTACTTTAACATCTTCTCAGCGTCAGGAGGAAGCATTCCGGTATGTTTGGTCAGCACGTACCACTTGCGGAGCAT
GTTGTTAAACTTTTCCATCGGGCATTTGCCTCCGTCGTGTAACTCTCCACACGTTGCACACCCGTAGAAACACTTGTCAGAGGGGTGACCTCGGCGTCCG
CACTTCTGACAAGTCAATCGTTTGCAGCATCCACGATCATCATGTCTTTTCGACCCACAATGAGTGCACGACTTGTGTCCTCCTGCATGATCCTGATCAC
GCTCCCGGTCACCAAGTCTTGGCTTGGTCGGACGTTCATTTGCTCGATCCATCGTTTGGTCGGCTGCCGTGGCGCTGTAAACACGTCGTTGTTCTTCGTC
TGAGTCTGAACCGCTTATATCTGATTCCGAAGAACTGCTCTCGCCCACCACGTGGATTGCACGCACAAATAGTGCCGTTTTAGATGGACTTGGGGTGTAT
GGTGATGCTGATCGTGAGCGGAACTTGCTTGAATTGGTCGGGAGGTTGCCTTTGCGTTTCTGCATACGTTCGTATGTGTGTAGCGTTGCTTCCAGTGTAT
CTACGTCATCTAATCGCAGCAGCGTTAATTGTTTCGCGATGTATTGATCGTCCAGTGTTTCGATATAGTGTTCCACATGGTCACTGCGATTAGCGAGATT
CCCGTCTTTTTCACGCGAATCTTCGCTCGTATCCCAGCAACGTTCAATCGGTATAGATATTCTAACGGAGTTTCATCGGCACGCTTGCAGGCATGATAAT
AATGGCGACCAGCAGAGACGCCGCGTCCGCAGTATTGCAAGAGGAAGCTCTCGAGTAAGTCTTTCCACTTATTGCGTGTCGGTCGACCCAATTGGGAATA
CAAGTTTCGTGTTGGGCTCGTTACAGCAGATCACCAAAAACCAGACACTTCTCCGAGTTGGGGGCTTGGTCACGCAAGAAAGCTGACCTGACTTTGCGTA
CTCATCCTCAAGCGCGGTCATCGTCGTGATCGCGGCCTGAAAATTCTATTAACTCGGCAATCGCAGACATGCGAATACGCTGCGCAGAAAAACCTTCTCC
TGCCTGTTATGGCCTCTGTGGTAGCCAAGTGGGGTCGTCGAAGGCCGTCGATATCGAGATCGTCAGTGTCGAATGCGTTGCCGCGGCTGTCATACGAGTC
AGCTGATTCCATGTCGGTGTCCGGCATACACGCCCCGAACACATTGTGGTTGGGGGTAGGGCGACCGGTTGGCACGATACGGGGCGGTTGACGGTGTTGG
TCCTGTTAGAAACTTTTCCATGGCTTTTGCAAAGTAGATTTGCAACTAGTCGGATTTATCCGTAGCAGGGACTTGCGTAGTGGTTGAATCCATCGCCCTG
GTGGTTGGTGCCGTATGCTCGTGGTGGTCACGCAAAAATGCTGATCCGGAAGGTCCCAACAACATTCGTTTGATCTCCATGTCATCGATTTCCTCTGCAT
CCGACTCCGCAGAGGCGTAATGCGACGACACAGCCAAGGGATGTTCTTTCTCTTTGAATTTGACGGTGGTCGTGAGTTCTTGATCAGCGGAGTCATAATT
ATCGGCCAGTGGGACCAGCGCTTTGAACAGTGATCGGATGGCCGTGATCACCTGATCCAGGTCGCAGTCAAGCAAAACCTTCGCATCGAACGCCCCCGGT
TTAAATCCTGCGCCTTGTAGTATTCTAATGATATGTTGTCCCGCTTCCATTTTGCTTGTGGCAGCTTGTGGTGCTATTGTAGGTCCTTGGATCGGTCCAA
TCAGCTCCGGTTCCAAGATCGTGAGTACTGGATCTGTTAATAGCAAAGTTTGCAGCTGGGTCCATGGTAAACGACGTTGTAGCTGATCCATCTTTCAACA
TTCCATCTTGATCTCTGCTGCCCCGCTCGTTTCCTGATTGTCACCCTCGGAGTCAGGTGCTCGTATCTTTTGAGCCGTAGCGTTCGGTCTATTTTCTTTG
TATATAGTTTTCTTTTTAGACAAAACATATCATGCTTTGGCTGGACGTGTTCCATCTAGCGGGTCGTACTTTGCAGTACGACCCGCGGTGGTCCCTGAAG
GGACCTCAGGAGATAATAGAGGTTTTTCTTCGAGATCACCTGATTGATCTTCCTCCTTAATTTTCGGTTCACCCGAGCGCCTCCAAAACTCTGACGACCC
GAGGATCCTTGATGATCAGGTGTATGAGACAATCCCTTCTTCGCCGACACTTCCATCTCCGGTTCAACCTTGACCTTTCCATCTTCGCTCTGGGATTCAA
GGTGAAATCCCGAGTCAACAGAAAATCCGGGCACGCGGACCATTGCGGTGGAGTGGGATTCATTCATTTTATGAAGCGATCCCAACTCTCTACTTGCGCC
CGGACGACCGATCAACGGAGGGGGTACTCCGAACCGTGTGTCTTGTCTTGTTCCTTCTCACCTTGTGTACCCGTCGGCGAGCGGGTTGCACTCTTC