Description :
From Genome Similarity Track
Location :
Scaffold_5:74368- 75924
Transcript NameFunction/comments
Albla_Nc14007830ADPribosylation factorlike protein putative

Sequence
1556 bases(100 bases per row)
GTAGATAATGACCATGAGTATCTTCGAGCTCATGTGGATCCAGTGCTGATGCCTTTGATCGAGACATTATTACTGTATCAGCCTCAGTGTATACATGAAT
TTATCCGTGACTATACTGATGACAGCAAAGTAGAAAGATTCCAGCACCGTAAGTATGCTTTTCCATCACGGCGATCTGGGATCCGAGATGGAATGGTCGA
ATACATGTCAAGCAAAGTTATCCCTGTTATGGATGATTTGTCGAGACAGATCTTGAAGGGGAAACCGAACAATGTGCGAGGTAATGCACGTAGCCACATT
GACTGCGGAGCAATTTAACGAGGAAGCTTTTCTGAAGAGTTTATTAGATCAAATGTTATCGCTCATATGAAACGTGACAAAATGAAGCCATCTGAGTTTG
CCTCCGGTGAAATTGTCATCGGTAGCCGCGTAATGTGCCGATATAAAGGTAGACCTCGAACTTTCCCTGGGTTTGTTCAACGACTCAGTCCGGACGGTGA
ACATTTCGATATCAAATATGACGATGGTCGAAGAGAAAGAAATGTACATAAGCTGTGTCTTTACAAAGATAGCACTTGTCCCGAAACACTGTCACCTGGC
AAAGACACTGCAATACCTACCAACATAAAAGAGGACCTAGTACTACTCGTTATCGGGCTTGATGGCGCCGGAAAAACCACTCTTTTGTCTACACTTCAAG
GAGACCCCGAGAAAGAGCATGTTCCTAGTGCTGGGTTCTCTTCTACTACATTCGAAATTGCAAGAGGAACAGCTACATTTTATGACCTTGGAGGCGGGCC
CGCTTTCAGGAACGTCTGGGAGGAATATTACGCCGATGTAAACTCAGTTTTTGAAACCGATTCGCGTTTTTTACGCGTTTCTTGATTAGGTTCATGGAGT
CATTTTCGTGGTCGATACATCCGCAAGTAGTTCAATCATTGAAGCGGCTTCAGTCTTAAATAAAGCAGCATCAGATGACCGATTGAAGCAAAAGCCAATA
CTGATGTGCGTAGAATCCTAACCCTAGCCATCCAACGGTAACGATTGTTTATGTAGTTTTGCGAACAAACACGATGTATCGACTTCTGTAGATGAAGATG
TTTTTAGTTTGCATTTCCACCTTGATGTATCAGAATGTGTAAATATTGTTCCTTGCATCGCGAAACCTTCTCGGAACAAGAAAACGGTAGATGAGAGGTT
AGAGCAGGGTTTGAAATGGCTATTCGAAGTGATCTCGTGCGACTTCCAAGAAATCAATGGTCGCGTACAATTAGATCGGACGAAGAAGAAGCAATTGGAT
TTCGAGCGCAAAGAAGCCCAACGCGCCCGTGTCATGGCTTGGAGAGAAGATAGGGAACGAATTGAGATGTCCCGGCATGATGCACATGTTACAGAGGCTG
CTTTAGCGCTCAATACAAACAGGGCAATGGATGCTAGACATTCTTCAGATAAAAAATCCATCATTTGCTGGAAATGCAAGATACGACCAGCCGTGTCGAA
ATGTGCGGCTTCCAAATGGATGCCTATATGCGATGAATGTGCACACTCACTGAAAT