Description :
From Genome Similarity Track
Location :
Scaffold_29:743485- 744788
Sequence
1303 bases(100 bases per row)
TGCAGATCATTTCTCCGTGCCGAGCTCGTGGGAGACCTAAAACCAAGCCAAGAGCAAAGAAAAAAACTGTCAACAAAGGTATCAGAATGACGCGTATGGA
TTCTAACCTACTCAGCTTGAATATGAGCTTATCATCCGTCCAAAGTATATGACCGGGTCTGAAACGTACGAAGCAGCTAAATCTCTGCAGCAATTCTAAG
TTTTTGGGTTGAAGACCAAGTTGAAGCCGCCGAAAGCTCACAAAATTTCAAGTTTACCAGTTTCCAAACTTTTAATCAATTTAGATCAGCTCCACCGCGT
TTTACCCAGGGATTATCTCTCGAAATGTGACGCTAAAGTGTCTGCTACGCAGCGTAAGTTTGTTGGGCTGGCTGAAAAAGATGTCGCAGTTGAAGTAACT
GGAGTTGGAGTTTTCAGTACATCTACGCTCATGTATATGAAGAAGTGGCATCGAGCGATGGAAGCAGTGTCAAGGATCGACAAAACAAAAGAGTGGATCC
AATGTGTCGACTTAAATAACGACTTCCCAAACCATTTCGAGGTGGAACGAAGTGACGATTTGTTCAAGAAATTAGAAAAATTACCTCTGAATCGCGAATC
GGTACGACCTTATTTTTTCACATTGGATATTTTTATTGTGTTAATATGCTAATTTCTTGTGATATAGATTCATGCTTTGGATCTTGCTGCTAGAGGTTGT
GTCGGTGATGATACAATGTGCATGGTTGCCGAAAAATTATTCGGTACGGATCCAAACGTTACACTAGTTGATCCATCACACTTGGGCATCGTTCTCAATG
GGGAGATCACGGTCAATACCGATAACATCACTGCTTTTTTGCGCGCGAATAGCAGTGAGGTGGTCCTTATACCGGTCAACTGTAGCGGTAACCATTGGTG
CAGCATCATGATACAGTCGTCATCACGGGAAGTACACATCTACGATCCAATGAGCTCAAATTACGTCACATTTGCTCGAGCTGCTGCCCAAAAGTTGATA
CATCTTCTCCGGAAAACAGCAGAGGAGCCATCTTACAGCGTTCACATTTACAGCTCCAATGTTGGAGTACAATACGACAGCTACAATCGTGGTATCTACG
TGCTTTTGAGCTTCGAGCACTTTACTGGTGCACCTCAGCTCGGACGAGTCGACAAAAAAATGCTGCAATGTCTTCGATACCGGTACCTACGAATGTGCTA
CGGCTGAAAGTGGAGAGGAGCATATATAATCCTTTATATTACATTTGTCACCTGTGTGAACGCTCGAGGTATCACATAAATGACCTGCACGAATTGGCGC
CCG