Description :
From Genome Similarity Track
Location :
Scaffold_448:7434- 9043
Sequence
1609 bases(100 bases per row)
GTTCTACCTAGTTCTTCTCCAGTAGGGCGCCTCGCGCCTACTGGGAGTCGACATTTCCGCGCCTCGCGCCTACTGGGAGTCGACATTTCCGCGCCACGCC
TTCTTTCTGGGTGGGCGCTGGGTTGCAGTTTGGCCGATACTGACGCGGATTTTGCAGCGGACCGTGGGAACAGAGGGGTTTCGTGCTTTTACACGTGTAA
CATCTACGGATGTTATGTAGCTGTTCCACAACTTGCATCTCTGCTTCTTCGCCTTCAGAGCTGAGCTCCATGGAATGTGGCCTATCGAGCTACCCGTCTC
ATACCAATGGGAACCGTAACGAGGTGATTTGAAGTTTAAATTAGCGTTCAACGGCATGTCCGCCATCTCCTCAATGTCGACGGGTGGACCCAAAATTCTT
CCTTCCTAGAAATTCTAGTACGGATTCCTTCCCCAAAGATGGTTTATCAGACTTCCTCTGGAAGAGGATCCAGTTTCATAGCTGTAAAAAGAGTTTGCAA
CTCCTGAACACAGTCCTATAATTATTTTCCACTCTGGCGGGCAGCTAAAAATCATGATCGTACACTATATGCCTGATTAGGCGGTGCGAACACTCAATCC
ATTTGTCTCTTAAGCTAATCCCACATGGGCTTGCGCGGAGTCTACAGACACATCACGCGTTAGTGCCCATTCTCTAGCTCTGCGCCTTGTTTGGAAATAT
CCATGCCAACTCGTTGTTGCTCGGACTTGAGCATAGCAGCTCTCATCACTATATCTACTTTTAGGAATACAGAGTAGGATGTTTCCCCCCTCTTTTCCCT
AGAAAGTCTTAGCATCTAGATCGAGTGGGTGAGCCTTAGGCTCATCTTCATCTATTTGTACATCGATGGCATAGCCGATGCTACGTAGTCATGGACCTGA
CCAATTAATGTGTCTTTAGGGTTTAAAAAGGCGTCCAGACGCGTGTTTAGCACGTCCGAACCCTGCCCCACAACAAGGCTCAATTGCTCGGCACCTATCA
AAGCGAAAAGATTATCAAGAGCCAAGCGTTGAGTATCAGAGAGGTGAGCAAGATACCTTATTTAAAAAAGTATCAGTCTTATAGACTCAGGTGTAGGTTT
GACTCTAGTGCAGCCAAGTTTAGCGGGGCATATATATCCCTTGGTCAAAGGAAGACTTTGGCTCTAGCCACTTAGTTCTAAAGAACTAATAACAACGAGT
TATGATTATACCCTTTCTAAAGAAGTAGGTGAGACTGTACATTCAGCAACCTTAAAGCTTAACAGTTTCAAGAGAACTAACAAAACAAATAATCAGGAGT
ATGAAGTCTATAAAGACTTTTACTCCTCTTCTCAAAAGACAAACTGAACATCATTTATGACTTATCTGCGGTAATAAAAAAAATTCAAAGTACCCTACCC
TAAGGTAAACTGCACCATATTAGTATGCCGAATAATTTAATGAGTAACATGTCAGTCACTCATCAAAGTATATTTGACGTAATTGGTACTTTCTGTAATC
GTTCTAGAACCTTAACCGATAAGGTACGATATTACTGATATTACTTTAAACGGTTCAAACCCAATATGTCTCTATATACATCACCAACTTATAGGATGTA
TAGTGACCC