Description :
From Genome Similarity Track
Location :
Scaffold_1034:7433- 10960
Transcript NameFunction/comments
Phyta_totarag11817hypothetical protein

Sequence
3527 bases(100 bases per row)
CTTTGGTTGAACTCGTATAACAATGCTCAACAGTTGAGCTGGGATGCCGGGAGCCACTGCGGTTCCGGGTAATCCTTCCACTTAATCAAGTATTCTCGGA
CTCGCCTCGAGGTCCGGGTTCGTTTCACCCAACGCACATCTTGGATTGTTTCAACTTCGTAGACATCTTTGTCATCACCAGGTTCCGACATATCTTCAGG
CAATAGAGCAGCATCAAAGTCAGCTTCCTCTGCAATGTCCACTTAGATAGTTGGGCGATCTGGGAACAGAGCACGCGGCTTCAGGCGACTCACATGGACC
CATGGGTAGACCTTATATCCAGAGCCTtcgatcttcagcttgcAACGGTAATCGTCTGATATTTCCATGATGCGGAACGGGGCATACCAAAGATGTGCGA
ACTTCTTAGTCAGCCCGGGCTGAACCCGTGCTAGATACAGCCAAACAGCGTCGCCAACCTGAAAACCTTTCTTGAGCCTGTCGGATAGCTGCTCCCAGAT
CTTGGTTTGAGCTTCTGAGCGCTTCGTCGTGGCTTCGGCTTGGAGATTCTTTGCCCAGGCTTGAGCATACTCGTATTGGCGCTGGACCTTCCGGCGCCAC
TCATAAGCTATCTTCTGGTCAAGCCCGGTCGGGGGCGGGCCTAGCATCGCGGACACGGTACTCTGGGATCCCAGCCATGTACAAGGTAAAACGGAGTGCC
TAGACGAGTAGCGTCGAAAGACGTGGTCAGAGCCCACAAAATATTTTCCACTCGGTCATCCCAGTCACTCTGATCAATTTCTGAGACAAAAGCTCGAATT
GCTCGAACTACAGTCTGCACAGATCGCTCCTGTTGGCCGTTGGCTTGAGGACGATATGCCAGAGTGGCTCGTTGTCGGCTCCCTAGAATTTCTCGGAAAC
TTCACTCATGAAACGCGGGTCTCGGTCATGACGCAACAGTGAGCTCGCGCCAAACCGCTGAAATACACTCTCCATCTACAGTTCCGCAACTGCCTGAGCC
GTGGTTGAGCTCATTGGTCGTCCAATCATGTATCCTGAAAACGAGCACTGGAACAGAAGCGGGAAGACGTTACCGCGGTCGGACTGGGGCAGATGTGTGA
CAAAGTATTCCCTTTCAGGTAAGCCCGGAGTTTCTTCGTCCAAGGTCCAGCCTCCTGCTGGGCAATGATGCGTCTCCACCTTTCCGCAATTGATGCTGTC
GGGGTCGCAGACTCAGGTGAGAATCTGATGTTCGGTGAGGCTCGTTCCTCCGCGACCGGCTCCGGGTCGTCTCCAGTAACATTTGGTGAAGCGTCCCTGA
CCCGGGTACGACTCCCAGTAACTACGAAAATCTTGGTGTTCGGGGTCaatggcgctgcagcttccgctAGTGAAGCCGACTCTGCAACAGTTTGCTCTTC
TTGACTATCCTTCAGCTCATCGTCTGTTTCCCTTCCGGCAGGCTTAGGCTCATTTAGCATCATCACCTTTTCCGGGATCCGGttcagctgcttgagctga
GCTAGTTCAACCGGGTCGTCAATGATGACAGGCTGTTGAGCCAAAAGCGTCTTGGTAGTCAAGTAGTCAGCGGCTGCGTTGAACTCGCGCTTCACGTGGA
CAAGTTTCACCGAACGAAAATTCGGGCTTAGCGACTCAAATTCGGCCAACAGCACCTGCAAACCGGGCTTCAAGCATTGTATCAAACCCTGAGCCTGCTG
AATCGCAATCCGAGAATCTTCCACGATAACTAGTTCTGAAATGTTCCGGGCCACTGCCATGCGAGTGCCTTCGACCAGACCATGGTATTCCGCTTCATTC
ACAGTGATGTTCTCAAAATGGAAACCACGAGCCTCGATCACTTCACAGGAAGGAAGCTTCCACAGGATGCACCCAGAACTACCGCGTCGACCCGAAAGTT
TGGCTGCTCCATCGAAACTAAGCAGCCGGCCTTCGTAGTCGGCCTCTAGCATCTCCAGACTGATCGGAGGGGGGCTCGGACAATTCGCCCCTTGGCCGGG
ATGAGATTTTCAGCAATCTTATCGAGCTGGTCACGGGGTGTGATCCCAGCTCTCAGAATTGCAGCCAAACCATCCTCATCTCGTTTGATCTTGTGGATCT
CTAACGGCCAAGGTGCGAGTCGGGCAGCCCACTGTTCACAGCGTCCTTCGAGTGACAGGGACCGAAATATTCATCGTAACACAGAATACCGCGTGTACAC
TTTCAGAAGCTTACTGTCCGCCAACATCGTATAAAATACTCTGAGAACTCTGAGTAGCGCGACGGACTCCTTCTCCGCTTGATGGTATCTAAGCTCTTGA
TCATGCAAAATTCTCCCCGTGAAACGCACAGGAAGGATCATTCCATCATACTCTTGACCTAACACCGCGCAGGCAGCCCAGGGATTCGTATGCACGATAA
TAAAAAACGGTTTCCCCATGTTCGGGTGTCTGAACAACGGGGTAGAGACAATTTTTTCTTTCAGGATATTGAACGCCTCTTTAGACCTAGTGAGATCGCG
TCCGGTTCGGATCTGTTCGTCCGTCAATTCGTAGAGGACAGATACTACTACCGGAAGGTCATCTATGAACTTGCTGTAATAGTTCAGGTTTCCTAGAAAC
GACTGTACTCCTTTCAATATCGACGGGAACGGTAGGTCTCGAATCCCTTTGGCGATCTTTGGTTTAGCTCGGATCCCTTCGGCGCCAATTTCATGAGACA
GATACAAGGTAGTCTTCTTGTCAAACTCACTCTTGGGAAGGCTCACCGTAACCCCCCAGTAGCGCAATCGATACAACAACCGATCCAAATCGAGACACAT
CTGTTCCCAGTTTTCAGCTCCATACGCGATATCATCGATATAAGAGCTTTGTCCCAGAACCGGGCTCAACTCAGGCGGAGCTGGGATATTTCTTCGGAAC
ACCGTCATCTCCTCAGTCAACACTGGCATTTCACCTCGCATATCCGAGTTTTTGACTTAATTCCTAGGAATTTCAACTCTTCAGCATCCacgtcagcttc
ttcgcaaGCTGGGAGTCGGACGAAACCCCAGAGACAGTTGTCTAACATTTGCTGATAGATCAATGGAACGTTCTTCAGACCGAACGGCATACGCGTCCAC
TGAAAGTGGCCAAGCGGACAGATCAAAGCAGAGATGTGTTTGGCTCGGAGTGTCATCGGCACTTCCCAAGACCCACTGGTCATATCCAGACTGAGAAACC
ACATTGCATTCTCAAACCCAATCAACAGATCGTCAATCAAAGGTAGAGGGTAGTGCATGAGCTTGATCAGTTGGTTGATCAGTCGATAATCGATACAGAG
TCGGATGTCAACACCGTTCTACAATGACGATCGGTGATGCCCAACTTGATTTCGAGTATTCGACAAGTCCAGTTTCCAACATTTTCTTGAGTAAATCGTA
CACTTTCTGTAGCTGGTGTGGCGGGATCTGCCGGGATCTCTGAGCAACGGGTTTAGCCTCTCCGACATCCAAATCGCAGACCACGCCTTTGGCTGGAGCG
GGGACAGCGTTACCATCTCCCAGAAAA