Description :
From Genome Similarity Track
Location :
contig_52:74316- 75598
Transcript NameFunction/comments
g8502.t1hypothetical protein PHYSODRAFT_251824

Sequence
1282 bases(100 bases per row)
ACGGAATGTGGTTCTGCTGCATGAAGGCCAGCAGCATTTGTCGCTCGTTCGGCGGCAGCATATCCACTTCTGCGGGGTCATGTCGCGAGCAAGCTCGGCA
ATGGCGTCGAACTGGCCATCACCACCAAAGCCGCTGGGCTTGGCACGCTTCGACGGGTCATTGTCTCCAGGTGGCGGCATCTGTCCTTGGTCAGCAGAGT
ACGGCCTCTTCGCCAAGCGCGGGTCTCGTCCTGCGCGTCGAGGGTCACGATTAGCATGTGCCAGGTTACTGCTGGGTGGACCACTAGTTGGCGTAGGCAT
CAAGCCAGGCTGAGGCTGCATTGGACTCAGCGATGGTGCAGAAGCTCCTGGTCTGTTAGTCATGGCAGCACTCGATGACTGGGTGACCAATGGACCAGGC
CGTGCGCTCCAACGGGTGCCCCGACTTTGCGGGCGCTGGAGCATGAGGCGCCATCATCGCCGGCTGGACGCCTGGTGGAGCCATGCCTAAAATGCCAGGC
CCAGGCCCCATCAGTCCGCCCATCGGCGGGCGCGGTGGAGGCGGCATCATCCTGCCAGCCATCGGGGGCGGCTGGTGCATCATGGGTGGAGGCGCTAGCA
GCACCGCTTGGGTCTCGGTCGAGGACGGAATGGAGATCTGCAACGTCTTGAAGCTCTGCACAATCGCGTGCGTGAGTGCCGGGTTCGCCATCAGGATGCT
CTTCGTCACGTCCGGCTTCTGTCTGGCGTGCTCCTTCAGTTGTACCAGCATGTCGTACAGCTTGACTGGTCCCAGCCGAGCAATAGCCGACTCAATGGCG
TTGATCGCCATTTCGCCCGTCACCATCGACGGGGGTCCTCCCTCCGACCCGCCGTTCCTGAAGTTGCCGCCGCTGTTTCCTCCGTGCCGCTGGTTCCCAT
TGTCGTGGCGCTTCCTGTCTGCTCCTCCAGACTTGTCCCCGCCGTCTGCAAAGTCCACGCGCAGTTGCGTCCGTTGATCTCGTAGCCGTTGAGGTTTCGC
ATGGCGCTCAGCGCCGTCGCTCCGTCCGCGTACTCACAGAAGCCGTAGCCCTTGGGTTTGCCGGTCTCTCGGTCCGTCACGAGGCTAAAGCAGGGAAAAC
GTCACAAACTCAGCTCCAGAACCTTGTTTCGCCCCCGTTGAGGCTGTTCCGAGGCTCTCACGCACCGGAAATTCACGACGGAGCCCGCTTCCGAGAAGAT
CTCCTTAAGCATGTCCTCCGTCACATCGTACGGGATGTTTCCGACTGGAGAATTGGAATACGGCGCAAGAGGACACGAAAAT