Description :
From Genome Similarity Track
Location :
scaffold_54:74302- 83502
Transcript NameFunction/comments
Pl_111003hypothetical protein PHYSODRAFT_351619
Pl_111004hypothetical protein PHYSODRAFT_286387
Pl_111005hypothetical protein PHYSODRAFT_509250
Pl_111006hypothetical protein PHYSODRAFT_315971
Pl_111007conserved hypothetical protein

Sequence
9200 bases(100 bases per row)
AGTAAACTTCGAGCTCTGGAGAAACGAACATCGCTCCCTCAAGTATTTGAACAGTACGAGCAAGAGCTGCGAACGCTACATGCTCAGGTACAAGAACTAC
AATCACGGAATGTCACACTTGAGCTCCGGGTAAGAGAGAAAACTCTGGCAAGTGACCGACCATGCAATTTCTAATCATTGCGCTTAATGTTGTTGTGTAT
TGCAGGTTGTAAGTAGTTCTGATCGTGGTGGTGTCGTGGGTGGCACAAATGGAGCTTCAATTGAGTTCAAGAAGAAATACCAGCAAGTTGTGGAAGAAAA
GCTGGCACTTAAGCGAGAAATGATGGAGTTTCGCAAGAGAGAAAGGTAGATATAACCTAGCAAGCAATCGTAAATGCTTGCTAAAAAATTGGTTGTGGCA
GGCATTACCAAGTTCACAGCCGGCTAGCAGGCGAGTCTACTCGTCGTGTAGACCAGTTATCACGGTATGACACGGCAAACCATGTCAGACCCTAATACGA
AACAAGACTAACAGATTTGTTGCTTAATATGATATAGCGACTTGAACAACAAGGAAGAGGATCTGGTAGCAACACGACTGAGCAAACAACGTTTGAGCGC
AGAAATGAACCAGGCTCTTGAAAAAGCGGATCGATTGCATCATGAAAATGAAAAACTACAGCAAGAAAAGGCAGCCACGACAGAAGAACTTCTTGCCACG
AGGATGTATCTAGCATCGCTCGAAAATGTATGTTACCTTGACTCCTTATTGCGTATTTGAACTAACGGTATTGCAATGTTCTAGGAGAAAAAGAAGGCAT
CCATCCTGGATCGCTTTGTTGAAAAGCATGGCGATCGTATGAACAAGCTACGACAGCGAGGTCAATCTTCGTCATCCAGCAAAGGTGAAAGTTGGCATCG
CGACCAATACGCACGCGAATGTGAGGACAAATTGCTCGCAGCAATTAAACGGTCACTTCCTCAAGCCGTACCGCTTTGCAACAAACTCCTTCGTCGTCTA
GAGATGCAGGAATTATCATTACGAGAGTTTTCTGAGCGTGAAGTGGACTTCATCAACCTCCTCGTAGAACTAGTGTCAGACCAACCTACAGTCTCACTCA
AGCAAATGATCGAGCAGGAAATGAAGAAACTTTAAACAAAATTGAGTTGGCAAATACCAAGGATTCTGCATTATCAGCATAGAGCCATCAGCATCTGCCA
TCCTTTTAGTGTCTTTCCTTCTCAACGATAACAATGCTCGAAATGGCAGTCGTTCGTGGCAACAACTTGGCACTTAGTCGACCTGAGCCATGGCAACGTC
CTGCTCGGTGAACTTGCCCTTCTCGGTCTCGCTCACGGCGCGGTTCTTGCGCTCCAGGATCTTCTTGCGGTCCTTGTCAAGCTTGAGCTTGGTGATGACC
ACCTTGGAGGCGTCAATGCCAATAGGCACCGAAGCACCGTTGGCCTTCTCGCGCACCACACGCTCGACGTGGATGACGAACTTCTTGCGGTACACAGCGG
TGACGCGGCCCTCGCGGGACTTCTGCGATCCACGCACGATCATGACTTCGTCCTCCTTGCGGATAGGCAGGCTGCGAACCTGAAATTGACAATAGAAAGT
CATAAACCATGAGCTCAACGTCACAGGACTTGGAGTTGACTGGAGTTGTCGTCCGGATGGTCGACACTTACGGTTCCCGCGATGCCATGAAGTGCCAGAG
TCGAAAGAGCTCTGACATGGACTTATAACGCTGAAAGTACCAGTGTACTAACTTACATTGTACTTGTTCTGCAGCTCCTTGGACAGAGGCGCGCTCATGA
GCACACGACGCTGGGTCGAGTGGGCGCCGAAGTGGGCCTTGCGGCTTTTGCGGCGCGACGAGGACACGGTCGAGTTGAACTTCACTGTAATTCATACATA
AGTAGCATCGAGTGAGCCTGTTGTTTCTACTGTGTACTAGACATTGGACATTTTCATAGCAGCAGCAACGTACTCTTGTTATCACGTAAGAAAAGAGATA
CTGGTCGCTCCGCTGAGCTGTCGAGTAGCGGATGGCCTGGAAGCCAACCAAAACCGAAGACAGAGGTCGATTTTCGCGGTTAAAGCGACGGTTAGAGGGT
AGGGTAATAAAGGACCGGTTAAACGAGATGGTACATGGTACCACATTTGGGTGAGTACAAGTTGAAGTGTACGCATGTTGCATTATTTGAACGATAGGGG
GATCTGGCTAGGACAGCGAGAGGCGGGTCTTGCGAGGAGTATGCAGACTGTTTCTTGCTGATCGACTCGTGTTACTGCGTGCTCTGGATGGCACTACCAG
CTTTTGCTTTAGAGCGTGCTGTTTGTTGAAAAAGGCATGGGTTAATTGTGGTAGGATTTAGCGGACGTGAGCGATAGATGAGCTTACCTCAAGAAGGAGA
GTGACAGGCTCACAGGTAGTCTGCACGTGTGAATTCTTTAGAATGATTGCTGCACTTGGCCTCTTTGTTGGATCAGGATGCATCATCTTCATGGTACAGC
AGAGAGTTAGCGACAATTATCACAGACAGCAGCATCCAGGCAGATAATTTCGAACCTGTTGAATCACCTTGCTGAGATCTTCCGAGTATTCAGGAGAGAA
AGAAGGGAAATCTCCTTCTCGAAGGCTATGCCACTCTTTTCCAGCTTCTGGTAGATCCATTCCTGTCGCAATCTCCAACATCATGATACCTGCAACACGA
TGTTTGAGTATCATTATCAGCTGGAGGCCCTGCTAAGTTTTAGCTTACCCAGACAGAAAATATCTGCAGATGGAACTCGATCAGCGCTGGAAAGCAACTC
CTTCGCCATATACTTCGGATCTCCTTCGAGTTCACCTATCTTGCTCGACTTTTCGGTCAATTTTACCACTTTTCCAGCCATACCGAAGTCACCAATCTTC
AACCGTCCATCCTCGGTGATAAATATGTTGTCGGGCTTGATGTCCAGATGAACAATATTTTGCTCATGGAGGATTTTTAACCCGCTTGCAACACCTCGTA
ATATACTCCACAAGCATTTCTCGGGGAGTGCCTCTCGATTTCGCATCGTAATAAAATCTTGTAGTGTACCACCCTCGCAGAGCTCCATTTGCAAAAAGAA
GAAACCTGTTCTCAAGCATACGGGCAGTCAGCAAGTAGCGAACTACGACATTTGTACTACGAAAATGGAGACTGCACCATTTTCCTGCCACGCTTGATAA
TACCGCACGATACTATCGAAATTGTGATGCGAGGTGGTCAACTTGTCTAGGACAGCAATTTCTTGGACCAAGATATCTCTGTTGGAAAGTAGTCAACAGC
AAGTAAGATGACTACCGATTGCAATTAAAGAGCATCACCAGTACCGAGGTCATACCGTTCTCGATCATTCCGCAGCTCTTGCTTAGATTTCTTGACAGCA
AAAAAACCACCACTTTTCCGATCTCGAACCTGTTCATTGCAATCATAAGTCAGTCGATACTCGCCAAACATTCTGACACCACTTTTCCGATCTCGAACCT
GTTTATTGCAATCATGAGTCAGTCGATACTCGCCAAACATTCTGATTCAAAGACTTGTCGATACCTTGAATACTTCCGCCGAGACGCCAGCACCAAGCCA
ACGAATGGTTTGCAAATCTTCAAACGACGCAACAAAGTGGTTCTGTACGGTAATTCCAACCCCACCACAATCAGTAACATCTTACCAACCACAAACGCCA
ACAAGATACCAACCGAGCAATCTGCAACGCGTAACTTCTTCAACACTTCTCTCTTCACTCGACATCGCCGAATCTTTACGGGAGTTGTCATTGACAATGT
CGATCCAAGATTATTGCTCAACAACGTCGCAGGACTCGCACACGGCGGCGACACAGATCTACTGCATCTACACACATTACTATCAGCCACGTACTACCCC
GTTACATCCTTCCAGACACAAACCGTTTAGTAAGTCCAAATCTCCTATGGGACGTCGGTGTACTTTGCTCGGAGCTAGATCTTCGTTGTTTATTAGACGA
CTGCAATGACCTCCAACGATACGGTGGATCTTGTCTTCCATACACATCCAGACGCTCCATGCGACGTGTGCGGTAGCGAAAAGTGCCTCCAGATACCGTT
TTACCGTCATTAGGTGTCTCATCACTGTCGTTTTGCTTCATATTCTCCTGTTCTTCATCGTTCTCGTCGTCGTCACTACTCACGAAGCTCAACGTCTTAT
CCACACGTGGAGACGATGCTTCCTCCATTGCCGCATGGAGAGATCGCGCCCTCATCGGAGACGCCAATTCCCGCGTCATTTTGCCTAATTTTGCCGCAAA
ATATTGTGAGTTTCGTTCCTTTTTTAGACCAATCACAAGCGAGAAAGCGTTTGGCCGATGGTATTTATAGCTCTGCAAGTGGCAGGCTAAGAGCTCATCA
GTCTGGAGCTGTTCACGACGCCGAGATGCTGGGCAAGATCACGCATTGGCTGGCTACGCGGCATGAAGATAAAGGCAGCGCTAGTGACGTGTTTGTGCAT
CAACGCTACGATGCGCTTGTATGTGGACTGGAGTTGCAGTTGAAGAGAAGTGAAATCTGAGAATTGTTTGCTCTTGAACTGTAGGCGCGACTGAAGAACG
CTACGTTGGCAGTATTACGCAAGGAAAATGCAGCGGAATTAGGTGATATCGAGCAGCCAGTGACTGGGCCGCAGGAGACGGGGTTGCCACCACGAGAGCA
ACGTCAACAGTTGACAGAGCGCGATTCTTGTGTCGGAGAGCTCTGTACGTAAAGTTGCGTGGCTTATTAGCTGTGAATATTGACGTTTATCGGGTGTTTA
TAGGTGTAGCACTGGAAGAGTGTTTGGTGCTGGGGCTTAAGCCTCGTAGTGAAGAGGAGCAGCCATCTTGGTGGCATGTGTTGTATGCCAGCACGCTCAT
TGTTGATGAGCCGACGCTGGTGCAGAGTGTATTGTCTGCTGCATTCCTATCGGAGGTTTGTTTGAGCTATGGGTGGCTGCTGAGTTGCATTGTTTGATGG
GATTCTGGTGGTGTTGGTAGACTGATGTAGGAAAGGCACGTTGCTGGTTGAAGATTGCGCTGAATAACCACACTATTGAGTCGAGCATAATGGTAGGCGC
TAAGTATGGCTTGATTTGTCTTGTAAAGTGCTCACAATTAACTGTTGGTGGCTGTGTTGTACGATAGATGATCTTTTCAATGGCATGTGAGCATCTGATT
CGCAACAACTACGAGGAATGGTCTCTCGTGCGCTGCTCGGAGGGGTTGGGTTTGTTTCTTGAACTTATTATCGCTCTTCGAGAAGTACACTTTGCCATTG
AAGTGAATGGCGAGCCATTTTATTTACCAGAGCCGACGGAATCGGTAGAACCAGAGCCTGTTACTGAGAGCAATAGTGGAGAAATGGTCTCTACGATTAC
GGATGAAGATATTGCTGCTGCCGTGGGGGTATCACCTTCCAGGGCTGGATCATTCTTACCCCCTCCAGAAACCGAGCCAGTATTAGTCGAGATTGAAGAT
GTAAAAGACGTGGAGATTCAAGAGGCTGTGACTATCGAGGAAGATGAAGAGGAGGCTATCCAGTTACCTTCGGCGTTGTTTCCCCATCGTCTCAAGGGTA
TTAAACCATGGCAGTACGTATTCGGTGTCAGTTTGGCATCCCTTTCGAAAAACCCATACCACAGCCGCTACGCCCTCATTGACCCACTGTTAGCGCTTCC
GAACATTGTGGCCGATTGTGTTGCGATACTGAGAGAAAACCCTGACACTCCACGCTTGTTTCGTACGACAGTGCTAAGCATTCGTTTGAGCCAACTCAGA
GAGATTGTGGAAACTGAGGGTTCAGTACCAAAAGACCTGGATCCACAATGTGCAGGAGCCCTGCTCTTAGATTTCCTAAAAAACCTGCCCGATTCGTTGG
TGACGGACGACAAATATGATGCATTTGTGGCAGCGGGTCAACTGCGCGACGAAGACGCGAGTGTGCGGAATATCACGTGCTTGGTAAATGATTTGCCTGT
GCATTGCCAGATCGTCTTGAAGCGAGTGGTCAACTTAATGAACTACTTACAGCAGCCTGAACATAGTGAGCAGAATGGTGTGGATAGTTTCACAGCCTCC
ACTGTTCTAGCTCCCGTAATTGCATTCAAGAAAGACTCTGGAAGCGGTTTACCATCCGAACGCCCTCGCGGCAGAACACACTCTCAGTATCAAGATGTAA
GGTATGCAGCTGTCGGTGCCCAAGTAGTGGAGCGAATGATCGAGCATTACGCGACTATTTTCCATGATGTACGTGTGCAGGTTGTAGATGCACTCGAGCG
CTTGGAGGCCAAGAAGGAAGCACTTCGTATCGTCTCTCATCAGATGAAGCTCCTGCCGCAGATGAACTTCTTATCCGATAGACAACAAGTGAACGAGATA
TCTCGGTTGTTTCGAGAACATTTAGAAGGAAGCGACAGTTCCTCTACGTCTGCACCAAACAATTCCGCTGATGGACAAGTCACAGAATGCCCCAAGCCAG
AAGCTCCAACAGGCCTGGAGAATAGTTCTCAGGCTAGTGCCGTCGTCAATTTAGAACTAGATGTGCGAGGGCCAACAGTTGCGACTCCACCAACTAGTGT
TACCAGCAGTGGGGCTTCTTCACCAACAACCAGTGAAACAGAACAGGACCTTGTAAGCATCTGGGAGCAGTTTGGCTTGAACAGGTCAACAGTTCTGGGG
AATTTTGAGAAAGGCGGCGTCCTGATGCTGCGAGCCATTTTGTACTGGTTGAAAAATGACCCAAATGCACTATCGCTGCTAAAGATGCGTGCATTACCGT
CTGACCTGCCGTCTTACGATGCTGGACTGGTGGCATCATCTATTTGCGAATCGTTGGTGAAGCTTCTGAAATTATTGTAGGTGATATACATGCTTTTCAC
GTTTGTGAAAATGTGGAGCTAACGCGTTCTGTTTGTACTCGCAGCTTAACCCCAAAACACCCTGAGATCGACATCGTAGCAATGTCGTTGGAGCCATTCT
GGGAGCTATTTGACGAAGATGTGTACTTCAACAAGCTCTTCATGTTCATGTTCCAGGTGTTTGACCAGCTTTGGAGCGAGCTTGACCCAAAGGCAGCGTC
TTTTACTCGCGTAATTACTGAGACCGAGGGGATTATGAACGAATTATTAAAGATGGCCCCTGTTACAGTGAATGATTTACGAGTGGAATGGGAAGAGATA
AGGACACGCCGACTCGAAGCAGAAGAAGAGGAGGAACTGGGGGAGCAGGACGAGCTTGTTGAAGATGAAGTGCTGCGGAATGCTGCGCTATCAGACCCGT
CACTACTTTCACCTCCATTACGCCACTCCAAAAAGAAACCATCATTTGATGTCAAACCAGACGACTACAAGTCAAAGCTAATGGAGACGTCGAGTATTCT
AACACTAGAGCACATCGCGTACATCGACCACGCGTTACCGATTACAAGCCAATTGTGCCGGTGGTTTCGCATTTACAGTGTTGAGGCAAATGGATCATCG
TTGGAGACATTGCTTATACTTGCGAAAAAGCAGAGCCCAACGCTCTTAGTGGTCAAGGATGCCAAGGGAAATGTTTTTGGTGGGTTTGCTTCAGACGAGT
GGCATCATGCGTTTCATTATTACGGCACTGGTGAATCATTCCTGTTTTCTTTTGCAAACCCAAGCGCTGCGGGTGGGTTTGTGAAGTACCAATGGAGCCG
CAAGAATAGTTATTTCATGTTGTGCTCGGAGGAGTCGCTGATCATGGGTGGCGGCGGCAACTTTGGTTTGTTTCTGGTGCGTTCATCTACTTGTCAGTGC
ATCAGGTTTTTTTTACTAACACTTATACTGATCGGTCCTTCAGGATAGCGATTTATCAACTGGAACAAGTGGAGCTTGCGAAACGTTTAATTCGCCTCCA
TTAACGACCTCGCAAGAGTTTTCTTGTGTCCAAGTCGAATTGTGGGGATTCACGAGTGGAGACAAACCCGTTGAAATTGGTGAGCGACACAGGAAAAGCG
TATTGGACTAGCAGCTATGAGCGACCCACCTAAAGAACAACAACATATCTTATTTACTCTAATCTGGGAGATGGTAGCAGTGATGCCATCACGTAGTACA
AGTAGTGAAAACGGCGAACCCGCGTCAAAGTTGTCAGGAGCTGGTCCGTGTACCTACGTACTTACGTAAATGTATACTGGTGAAAAATAGTGGAACCCCT
CGATGCATTTTGCTTTGCCAGCTCATTGCACACTAACATCGCCATTGGGTTGTGTGAGTAATTGGCTGTCGAGTTCAGCTTCGAATCTCCGGAACGGGGC
TTCCACAGCTTCACGCTGCAACATAACACCAGACAAGATATTAGCAATAGTGAAGCTTGGATCCAATTAAATTCCACGAACCTCTTCAGCTGTGGGAGTG
GCGCTCGCCTGCAACTGCGGCTGCAATTGCTCCAGTTCGTGCTCGAATACTTCTGAGAACCGCTCAAGAATACGTTGCAGAAATGCCTTGAGCGCGGCAC
ACGCAGCATCAGAAGTCCGGTCATGGAATAAAACTGCCTGGATGGTCTCATTCTGTAGTGCGATCATGATGAGACCACCAGAGGAGGCCTGCAATCGAAA
AAATCACATTGGTGAGATATAACACACTATTACCCCACGATAATAGAGGTTCGTAGTTGCCTACAGGCATTGGACTGCTGTTCGATCGGTCCTTCTTGTC
TGTTCTGCTCGGGTCGAAGTGTACCTGCACAACCTCTAAAGGCAAACAGTTAAAGAGCACATACAATAACCCATACTAAACGTCAACATGCCGCACCTCC
GCCGTCGATCTCGCGGGCGAACTGTGTGAAGGACATGACGAGCGCATCGACGCCTTCTGCATGTGCCTGCGGATTCCACTTCCACTGGTGCGTGAATAGG
CACACGCCCGACTGCTGGTGCAGCACCTTGACCATGCGCAGTTCTCCAAGTAGCGCATTCATTGTTGAAAAACTACGGACGAGATAGATGTCTTCGGGAG
GAAATGCCGGCCAGAGTGATCTCTGCCCAAGTCACCGGACTTGACGCTATAGGTACAAGTATACTTAGTCTAGTACACGAGAAATATATGGACTTTTGTA
TGGAGATGCTATCTCAGCGATGCCAAGCTTGGACGAAATGTAGTCGACGAAGATGCCACAGTGCGGGCGATTCGCACTGTACAGCACCTCCAGCATGCCA