Description :
From Genome Similarity Track
Location :
Scaffold_546:7430- 13583
Transcript NameFunction/comments
Phyag_g6525conserved hypothetical protein
Phyag_g6526hypothetical protein

Sequence
6153 bases(100 bases per row)
ACTTTGCTTAATTGTTTTAATGCTGACATTGTAATCCTGTTCCCTGGTGCAGTATCCTGAGTGGCTGGCGGAAAAGGAGTCGTTGTTGTCGAAAGAGGAC
TATGAGAGGTTTGTGTATCGTATGCTTAAACTTGATTTCTGTTTTGACTGCTGTGCTGAACAGATTTCGGATGGCGTTGTGTACAGATACGGCAAACAGT
ACCAATACTTCCAACAAATTGTAGCAGTGTACGAGTCGGAGCCCGATAATTACGCTCGGCTGTCGGAGCTTATGCAAGAAATGCAGGAGACTGGGCAGCC
TCCTTCAGAGATCGTGAAGGATCTTGCTCCAGGTAAGCACCTTTGTGAAATCGATCTGAAAGTGTGGACGCAATCTTATAGAACTCGCCCTCAAATTTTA
CAGGCTTGCAGTTTGACGACGAGGGAATGCCGATCATGCCCAACATGGTTCGTCTTTCGCTGTACTTTCAACGTGTTGATTAGCTTCGAATCTAACAATG
GTTCTGTTTGTCCATACTGTACACAGGGTCCTGGCATGTTCCCCGGTATGGCCGGAATGCCTGGCATGCCCCGTAAGTTTAATTTGTGCTGGTTCGCTCC
GTTTGGCGCTTAGCTCAttaacattttttttttcattttttgGAACAGTTGGTGGTACGCCTGGTCAGGAACAGTGCTCCCTCATGTGACCTGATTGTTG
TTGTAGCTGCTATTCGTAACATTGCTGCTAGAAAATTGCAACGCCAACTCTACATACTCGTACTCGTTTGTCCTAACTTGGATCTGGCGTCTGTTCATTC
AGCATCAATCCTAGACAACGGGCCATGATGCAGCATCTCGACGCGATTTCCCTCGGAGTGTTTTCGTACTTGCAGGCCCACGAACGAGTATCTCGTGTCG
AATCGAAGCCTCTCGTCGGAGCGACTCCAGTCGAGCTTGGGCTGTGGGAGCAGGTGTGATAGATACGTGGAAAGTAGTCATTTACTAACCCCACGTTGGT
TTAGAAAAACTCTCCGCATGTGCTTCCAGACGATTTGAAGATGTTCTATTCGATCACTAACGGACTGTCGGTCAAGTGGTTTGCGCCATTTCGCGGTAGT
TCGCCATGACACCCACAACCATGTCAATTAGTGCTGAAATTGTTCGCTGCCGTATCAGACCACTCCAGTTTGGTGGGTCATTTCTTGCTGAACTCGCTTC
AGGACTTGCAACGCCTCTCGATCACGGATCTTGGCTCTCAATGCCGCTCTGCAGATCTGCATCGGCTCGACTTAAGAAATGTACGTCATCTTGAATACAA
TGACACGCGCTTCAATCTCTAATCTTGCGCTACCAGATCATTCACAAGGCACTCATAGGGTTTTCTCTTGAGGCATCTCCGAAGTACGGCACCGTTGTTC
TCGTGTATTTCGACGGTACATCCTTGACGTTTTCTGGGTTACTTCATTGCGCATGCTGACTCCTCAATTGTTCTGGCAGAAGCACCGCAAATCTGGTTTC
GAGATCTGCGAGGCAAATGGAGCTTCCTCGCCGAGACATTCACCAATTATTACCGCATGATGCTCACTCACCTGGGCATCATATCGTGGCAGGTGCACCA
ACTAAATAAAACATATTCACTTCACTTTGTACTCACTCGCTTTTCCGGACAGACGATCTTCTCGGACACTGGCGTTGACCCCATGCGAAAGGTGCACAGC
TCTCCGTAAAAACGACCTGGGCGCATCTCACGGGTTTCTCTCTTTCGCACATAGCCATGGCTTCACTTGTTCATCCCGAACAGAATGCTCCTCGACGAGC
AAGATGCGCGAGATCACGAATAcgatggagagcgacgaaAATGACGCCCGCACTTGGCTGTCTCCTACGTAGTGCGAATACTATCGACAACATTAAGAAC
AGACCAACGGAGAATTCATTGCGTTAGCCACTTGTGCTCTGACGTCGCAAGTTTGTCGGGCTTGTTTTCATCCTCCAAGTAAAAGATACTTTCATCTTTA
TACTTCAGCTTGCCGTAGTCTTCCTTCGAAATCGCCACCACCCTTCGCTTCACCTGCGATGACGAGATATCCAAAACTTTGACAGGGGTCTTCGAAAGCT
CGGGGTTGTATGGTTCGCTGATTGATCAATAACCCATCAAAAGTACCGTCAGCATTACGCGTCCACTTTTGTCAAACAAACGAAGATTACGTACCGTTTC
AACATGCCGACACGAAGCATAACACGACTTTCCTTGGCATGCTTCGACTGCGAGCCTTCATCTTTGGCGGGATTCACATGAATACTTTGGATCTCGCAGA
CATTGAACAAGAGGTAGTGATCAGCTGCACTACCCGAAATGTCCGCCATCACCAGTTCTCCGGTGTATAGCTTCAGTCTTGTACTACAAAATCAGAACAC
AGACAAAATTAATCGATCATCAAAATAGATAAGGAACTGAAGCACCTACTTATCACTGTCACCAATCTCTGCGCTCGCTGCAAAAACATCTTCGCAACCA
ACTCGCTGAGGCTCGAAGATAGATTCTTCCGGATCCAAAAATTGCTGGGTAACAATCAATTTCGTCAACGATTACATCTACAATCAATTTTCGCAATGCA
CGTCGATGCTTACCTGACGGATCATACACTCAGTAACCCACTGGAAGTCTTTAACGGGGATGTGACGTTTTTTCTTGTAGTACCGGCATGTCTGGAAATA
TTCAGCCACGATAGCAGCAAATGTCAGCAGGAGCAAAGCTAATAACAGGATGTGCCAATTCTAATTACCGGAGTATACTCGTCGctgagcaccacgtcca
cgcTGACATCGCTCCTACTTGACAAATTCTGAGAACGAGTTAGAAATGGAATATAACCGGACAGATTTCATAGAAAAAAGATCTCACTTCGTATACAGCA
TCGGCGCCACAAGCCTTTAAGATGAACGCCATAAGATTGGACTTGTCCTTCGCCTCTGACTTTGAAACTTGAGCCACATCACTGGCGATACCGAAGGAAC
AACCTTCAAAAATATGCAGCTACTCGGACAAGCACAAAACAACAAATCAGTAAGTAAATATAATCACTCATTCCGATTCATCATTGAAGCAGTGAAACTC
ACCACACGAGGGGAGGTACACTCGAATTTACGAGTGGTAACGGAATACCCTGTAGGCACTTGATAGCCATCGAATGGTATCACATATCCAGCTTCAATGC
AATCCTTAATCCAGTCAGTGTGGACGACAGGGATCCCACATGCAACTGCTTGCATAAACTTGCGTTTTCGCCACGATACAGGCGTCGCAATCACCACCGC
CTTAGAGTTGCCCTTGTAGAGGACATCCTGGTAGCGCTCGGGGATTTTACCACCATGCCCTTCAATCAGCTCTTTCAAATTTTCTTCGCCTGTCTTCACG
AATCCCGTCAAACAAAACTCAAACTTGTACTTGAAGAGCGTTCGAGATCTAGAAGTGTACGCACGCTGCGACGGTACCGATGTCAACATCCGTGTGCGCG
TTCGAATTGTCGGGGTCGAGGAAGGTGTTGACTGATTGGATCGAGCACTACGCCGTGCAGGAGGTCGCGGAGTAAACGGATCACCTGCGCTAGACTCTGG
TGACGACATATTGCCGTCAGGAGATAAAAATCCACGCCTTCTTTTCTTGGTTTTCGGGGTGGAGGTGGTCTGGGTTGAGGAATTGGTAGCTCGAAACgtc
ttttgcttctttttACTGGTAGGTAACCCAGACGGAGACGAGGGCATTACTTTCCTCTTGGCGCTCGCCTGTGTTTCAGTCGCAGGACGAGTTATCTCGG
GGACGGCGGAATCATCAACCGGTGTCAGTGTCGGCGTTGGCGTAGGAGTTGGCAAGCATACCGGGCTAATCGAAGTTTCAAAGGGGCTTGGCCTGTCACT
TTTAGAAAAGGCTTCTATCCTCTTCGCTACAGGAGTACCTTCACTTGTAAGACTTGCACTAAAGTGAGGCTCGCCGTCTTGTGATTCTGGCACAGAAAAC
GAGAATTCAAGACTGCGAATTGCTTTCGTCTGAGAATCGGCCCCAGTAGTATCTTTGTTTGCCAATATGTCGTCTCCAATCTTCGAGATGTTTTGCTGAG
AAGGCGAGTTCGGCTCGACGACGGGTTCATCCTCCGTCCGTTTAGTCGGTTGCGTTGGCACACAGTCGTCTAGGTCTTCATTATCTtgagccttcttctc
cgcgtTATCTTTTAcgtcaacgacaacgacaggATTGGCGGTCAAATCCAGCGAATCAGCTTTTTCAATTCGAGTGGGGTTGACTCGCGGCGTCAAATAA
TCCAGCGGTGTAGCTTGCGAGCCTTCACGACTCgtcacttcatcttcaccacTTGGTGCAATCGCGGCATATTCTCCACTGCAATTAACTTCCTTCCAAT
CGTTATTCTCCTCCTCAACATTaccatctccatcgataaATGCAGAGTACGCCCCATAAGGTAAAATCCCTGTACCAGAAAGAGGGAACGCTTCCGtctc
ctcatcgtcactgtcaccTGGAACTTTATAACGAGTCACATCCATTTCATCGCCCTCATCCAGCTGCTGTGTGCACTCCAAATCATCTTCATACTCCGCC
TCACGGTCGCTATCTTCCGTAACAGCGCTCATATCAAATTGTCCCTTATCTCCCTGCACCTTTGTCTTCTCATTCTCATTTTCACGTCTAGCAGCATTCA
CCAAAGAACCCGTCGGTTTAAACACCCGAAAGCCCCTCGGAGCCAAATCATCACTATACTCCGAGTACGCACTAGCTCCCGGCATCGAGTCTTCTCCGCA
TTCCTCTTCCTCACTGCCCTCCATTTTACCCTGTTTCTTTTGTCCTTTACGAGCTCTCCACGCCGTTTCCATAGTCTTCAACATCGTTGGCGGTGGACTC
CTGTTCTCCAGTCTTTTTACTGTTGAtatctccttcttcttctccgttaAAACCTCTGGTTTCTTGTattgcatcagcagcttctcgtcgtcctgaATCT
CTCCAGCGAATAAATCGCTGAACGGATTGTGAGCAGGTCGGAACCCATCGCCGCCTCTCCTGACGTTCCCAGCGGTCGAATCCAGGTTTACTACGGGTTT
TAAcgtctgcttcttctcctgctctcTCGTTATCGAATGCAGATCCACTTCTTCGGCGCTGGGAGGGACGTGAAAGCCTACAAACGCGGTAGGGTCGGCG
CTGCATTGTTGGGACTGGGCGAAGCTGTCGCTGGGACGACGTAAGGGGCTGTCGGGGCGTGGGAATGATACGTCGGAGAGTCGACTCCGACTCTTGTCCG
AGGCTGCAGACACGTCCGACGGACGCGTAGGAGACTCCATCCACGCCACTCTACCTACCGAGTTTTATTGAAAAATAATGGCGCGGGAGATTTGGACCGG
GTTTTCCCGCCAGAAGCTGGTACCGAAAATAACGCTAATTTCGGATCGGAGCGATAGGTAATCGGCGAGTTGTAGCCGCCGCCTGTGAGGTTATCACCTT
GAGAGGAAGAGACAACTACTACTCGCGTGAAATATGCGCGCCGATGGTAAAGCTTGGAACCGAGTGCGTATCTTCCTCGCAAGCTCGAATCAATTTTCAG
TTGGCCGGAATTTTTGAATCCTCTTTAGTCGCTGGTGAGGTCCGCAGCGACACGAGTTCACAATTGCTGAACAAAAGTTGTGGTGCATTCGTTACGGTTG
AGGCGACCTCGATTGAGATTCGTTGGACTGTGATCTGCTAAGGGTCGAGAAGGGTGACGATCAACAACTTTGGACAGTGTTTGCAATGTGTGTGTAGAAT
TGGTTGGAAAAGCCAAGGGGCCACCATCACTAACATCAACGATCCGAGTCGCAGTGATCGTTCTGGTAAATAACTATAGATAGCAAAGTGCGTATTGCTT
TAACTTGCGACTATGGCCGAAAATGCCATTGAAGGTACCCCCGATGTCGCTCGCAGCGATGGGCCTCTCCGCGACACACTCTTAGATGAATTCCATGAAC
GCCAGTTGCCCCAGCACCACTCGGGCGAAAGCTCCGTGACCAAAACGTTTGCCTCTCCCGGCTTTATCGAGTGTAACTGTGCCACTACAGCGAAGAGAGG
TCGCTACAATGAGGTCGTCTGCAGTGCCCACAAGTTGACACTGAGGAACTCAA