Description :
From Genome Similarity Track
Location :
Scaffold_1666:743- 6197
Transcript NameFunction/comments
Phyta_totarag13460hypothetical protein
Phyta_totarag13461hypothetical protein

Sequence
5454 bases(100 bases per row)
CGGCAGCGGGTGGCGAGCTTTCGCATGTCGAAGTGTCTGCTTCTGCCTCCTTcgcagcaccaggtccaTTGCCAACGGGTTCCCGTTCGTGTTGTTCCTG
GTGAATTAAGAGCAGCTCTTGCTCCGTCTTCCGTCTCTTCCGTTCTCGCCGCACACGAGCGCTCTCAGtcagcacctgctcctccaCGGTGCGCCGCCTT
CTCGCCACACTCTGCCTCAACATCGCAATAACACccgacgtcgacgttgcCTCATTCTCTCCTGCCGACCGTCTACCCTCCAGTGCCCTGTGAtactcct
cctccatctgcCTCAACTTGAGCGTCAAGTCTCTCACTGCTTCTATCCCCGCCACCTCCACATTCTGCTGTTTGTCTGCATCTCCCGTCGCCTGCTCCGC
CGTCTCGGACGATGATGCCTTGTCCGACCTCTGGCTGATGCGtttgcgcagctccttggcctccagaACGTAATCGGGCAGCGTCTTGCCTCGCGCGCAG
TACATTttcttgaacttgcgcttgagACTCTCCACGTCCCGGTACGGGACGCTCTCGGGCCGCATGTAGTTGAACTGATAAGCCACGCGCAACCAGTCCT
CGCCCGCCAGCGGCAGCGCCGAGCGCATCGTCGTGTTCAGCCGCCGCATCTCGTCCGCCGAGTAGTTGACCGTACcgaacttgctgctgcggcccGCAGC
CATTTCGGGTTCTTTTTAGTCGGGCTCagatattttttttcttacgACAATCCCCTCACTAGTGATATTATGACCGAGGGGATTGGCTGTATAAAATACG
GACAAACCGGCGTTCCAACAACTATCCTCCAGGGTTCTCCACGGCTGTCGGACCACGGACTTAATCTACgaatcgactggatcgaTGGACGTGTAGAACC
CTCGCCGGAAACCGGTATACAAGCCGGTGTATAGTTTCCACTTCGGGGTTGCGAGTTTGGGGGAGAGAATTGCGAGCGTCTGACATGGAACAACTGAACG
ACAACTGGGGGTTCCTGAGCGCAGCGTAGGAACGAAGGTTTCCGCTGGTGAAGGAGTACAGTACGCGGCATAAGATGGCGTGGACGAGGGTCTGGGAATT
TTAATTCGGTGCTCTGCCACCAAGGACTGGAGCACCTCGCCCCTCCAAGTCGGTCAGTTTGCAACTTcctgtcgacgaagcagtCACCAATCTGCTTCAG
CCCAAGCCGGCGTTTCCGCCGTTAGCCTCAAGTCGTTCCCCAGCCAACCTCATCGTCAAGTCCCATCATGACGCTGCCCACATCCAACGCTCGCGCTACT
GAGCCATCACGCGAGTCATCGCTGCGGTCGTCATCGCCCCCGCTCGTCGAGGCAGCGGTGCCCCACaaccagtgctgctgcgcaggaCTCGCCGGAGAAT
GCAGGCACGTCCGAGCCTTCCTCGACAGGCAACCCCCTCTGGCTACAGCGACCCCGGTCACCTCGGGCGCTGACGAACCGCCGGCTGCGGAAGTCATCGT
GGTCGACGACATTAACGTCGCACCCGCCCTGGTCGTGTCGACACCATCGCGGGCGATCACGCGCATTGCTTCTCGCAAATCCATATCGACGGCGCACACG
AAACCCAAACGCGTTACCAACGCCGTCCCGGGCCCTGCGCTTGAGACCgcgcgcaagaagaagcgcaaagCGAGCTCCCGCTTGACCAATCAAACGCCGG
CCGCAGATTACCCGCCCAGCACGACAACCACATCTGGTGTAGCGGTCCAAACCGAGGCGATTCCACCAGTCGCATGCCCATCGAACGGTGCAGCTCTTGC
TCAACCATCGCAGGCGAGCTCCCCTCTTCGGTCAAGTGTGCGCGATCATACGCCCCGCAGCTCAATAGTGTGGCTCGGCGAAGATGATTCGTCCCGATGC
ATGGCCCCACCTCCTGCGGGCACAGTGCCTTCGGGCGCGCCTCCCTTGCCAGTCCACCAACAACCGCGCATGACGACGAATCCACCACGCGGATGGCACC
AGCGGCATTCGACCTggacaagttcgtggagGAATTTAGTCGGTTAACCCCGGCGCCTCATTTAGCTCTACCTGCACCAGCCGTGCCGAACCCATCGCTC
GGTTCTTGATGGTACAAGCGCTGCAAGAGCACATGTAATCCCCTGCGGGGCGCGCACCGACAGCAGGTTTGTAGTCGCGGCCTGACCACTTACTTACCCC
TGGGTGATGCCGCCGATACCTACTGCGAGACAGTGATGTCGAGTAGGCCAACACTTGGATCTTCCGTGTGGACACTTCCACCGAACAGGAACCCGGGCGA
CATGCCTCCTCTTGCCATCCAACATCTGCGGTGCTCCAGCTTTCAAGCACCTCGGACTCGGGTGGAGGGCGAGTACCATCCGCCCCAGACGCATCAGCTT
GCGGCCCACAGGTGCTACAAGGCGCTGAGAACCATGGCAGGTGCGTACACCACGCCATGTCGTTCGATTTGCAACTGCATGAACTCGATTGCGTCCGCTT
CGAGGTAACCCCCGCAGTTCTCATGGCTGTGTACAGTGCTCGTCTTGGTAACCAAGGCCTAACTATCATGCACTTCAGGCTCCTCGCGGAGATGGAGCAA
CTTCGCCGTGGGTCGATGAACGCATACTTTGCGACGGACTTCGGAGTTGGTGCGGTGTTGCCCACAGCGAGTCCTCACTGCAAGACGTACGAAGACTTAC
TGGCGGTCATCAGCGGTCTGGTCTCGTTTGGTGACGTACTGTTTTTCGATCACACCCGGCGGCTGATGTCCCAACTGAAGCGTTCATCCTGGCAAACATG
GAGAGTGACGCCAATACACTGCAACGTGTCGCTCTGACACTTCTCTTCGCGAATACCTTTCTCGGTCGGGCGATGTCTCACCTTCTCGACGACTCGTCAG
CATGGTGGCGCAACTACAGTGACGCCGTTCGGGCCGTCGATTATCACGCCGCCGACTGGCAAGCTTTGCTCAACGGTCTCGCACTTCGGTTAACAGCTCG
AGCGTCTACCCCTGTCGCCCCCAGGAGGTCGTCATCACGGGTTACGGCTGCGGCTCCACGCCGAGCTCCTCCTAGCCGAGTACCAGTCATGCTCGAGCAC
ATTCGGCGTCAGATCCCCAGGGATTTGAACGTCCTCGAACCATGCCTGCACTTCTTCTGTGGGGGAATGTGCTACGGCGGCAGCACCGACCGTTGCGCCC
ACGTCATGCGTACGCGCACATGGGGCCGTTGACTGCCGTTCGATCTGCAGGATTTCATCGATCGCAACTACGGTCAAGGACCGCGCTCGGATACACGTCA
ACCTCGTCATTGAGGTTGCCGAGGTGACGCCAGCTTGCCGCCACTTCGGATAGCACGCAGCTTATCCCAATACACAATCAATGGGTATTCTTCTGCCAGT
GAGCCTTCGTTTGGTCATTCTAGACCCTACAGTTTTAGCCCCGCGACATCTCCTCCATTGAGACGTTCACCGTCTCGTGAGTCCACCATCACGACCAATC
GCATTGTAAGGACATCGCCCCGTGGTATGTTCGTTCCTCCAGCCGTACCTATCGCTACCAATCGTCGAGGCGTGCGCTCGGGGCCGTATAACAGCAGCAC
CCCCAACTTCGCCAGCACAGCCGATGTCAGTTCGCCCACGGTAACTGGCACTCAATCGGGTCGCCCCATGGCACTTCGCCCGCGGTGCTCCACGGCCCAC
CCACAACGACATATCATCTGGCATCCGTCCGCGATAGCGCACCAGCGTTGTCGTGCAGCACCGAGCAGGGTCCACTGTCGACACTGCAAGTGCTCCGGAC
CCAACGCGCCCCAGCTACTACGTGACCCGCGCCAACGTTCGCAAACAAAGCGCCAGGCCGCCGAGGCGGCGCAACGAGCAGCACTATGGGAAGCCGTGCG
GATCCGCCGCATCACCCGGGCACTCAACGCAGTGGGTCTGGAACTTCCACGCATACCCTGTGCTGTACACCGCGGGATACCCATCCTGAACAAACCTCTT
CAGGCGGTCCTGTCAGAATTTATCCGGCGTACACGCATGGCGTTGCCCGCGTTCGCGGAACTACTTCGCGGTCAAACTACAGAGGACTACAGACCCAATA
AAATGATTCCCTCCGTCCTGACGGCTGCATGTCAGGGATACGAGCACCTACCATGCATTATCGACATTGCGAACCCTGGGGCTCGCGTGCCTCTCCATCA
ACCGCTTCCGCGTCAATCGAGCGCCCGCCGAACCACAAATCAGCGGACGAGCGACACAATGTGCTCATCAAAATATTCGCCGAGAACAAGACGCTTGGCG
CAGTCTCGTCATGGACGCGGAAATTTTGGAGATCTGGCCTGAAGTACACATAAGTCCCTTTGGGGTAGCTAACAAGGGCAACGAAGACCCGAGGACGTCG
GGACGAGTCATCCACGACCTGTCGTACCCGATTAATCATTCGCTTAACGGCCCTACCGATCAGGACGCAGTGTGTCAGCCCGCGTTCGAACACTGCGACA
CAATCGCCGCTGAAATTGTACAGCAACAAACCTGCCACCCCGACCGCGACGTAAAATAACAAGCCGGCGACGTTGCATCAGCCTACCGACACGTATGTAT
TCACAGCCACTGCGTCCATCTGCTTGGACCGGGATGACGCGCTGGTACTTGACATTTCCGCGGCGTTCGGGTGGTCCGGCTCGCCCGGCAACTACGGTGT
GATGGCGTGGCAAATTGCATTCATCCACGGTCACACTACAAACGAATTCAACCTCACGGTTTCTTCAGCTACCATTGGGTCGGCGACCACATCAACGTCG
CGGCCGATGTGGGATCCAACTGCCAGGACATGAAGCAACCTCTCCGAAGCACCATGCTCACTGTACTCGGCCCAGCCACCATCAACGAGGACAAATTCAC
GGACTGGTATACCCGTCAGAAAGCGCTTGGCATCGCCTTCGATTCCACTGCCGGCACAGTGTCCATGCCAGCATCCAAAGTAGTCAAGGCCGACAGAATT
GTGCTCACAGCACTTGAGGTGACCACGCTACGCTGACCCGAATATCGATCTCTCCTCGGCTGCCTTCACCACGTAGCGACATGCGTCCGCCCGCACGGGC
GTTCCTACAATATCTCCGGCAGCAAGagcgtcaccttcaccgGTGGCAAACCGCCCCGATCACAGGCAGCATGCTGCAAGACCTCCACTGGTGGTTGCAT
ATTCTGCGCTCGTCGCCTCTCAACGGCGTACCTCTAGTACCCTTCCAGCCCcggacatcgtcgtcgaaatggAGGCATCGGACACCGGCCTATGTGCGCT
CATACGCGCCGAACAGATCGCGTTGGCGTATGTCTTCTCCGAAACCGAACGACAACTCATTGTCGACTCTAAGGTGTATCCAAACGTTGGGTTTGATATC
AACTACCGGGAACTACTATCGTGTGCATTAGCTGTCCATGTCTGGGGCGCATCC