Description :
From Genome Similarity Track
Location :
Scaffold_956:743- 2037
Transcript NameFunction/comments
Phyag_g8860endo-1,3(4)-beta-glucanase, putative

Sequence
1294 bases(100 bases per row)
CGTGGGCGGCGGAGAGGTGACGCTCAGTCCCTACACTGTCCGCAGTCTCCCTAAAAGACTGGATATCTCATACGGAGACTCCCGACGCGTGGCCACCAAA
GAGGCAGTCACAGAATACTTTAATGTAGATGCGAGCTTCACAGCCTACAGTcacaaggtgctggacggcaaTCAGACGGGCAGTGCATTGCTGGGAGACG
GCAATAGTACGTCTAGGAACGTCGTGGGCTTTGATGtgctgtcggcgctgctgcaataCTACTACGAGACAGACAACCAGTGGATGAAGGTGCCGATGAT
GCGAGGCTCGCCCTACGTGACGGTGGAGTACCAGAACGTGCTCCCTGTGCTGGAGTTCAATGGTACTGTGCTTGCTGTTAACAATGAGccggtggaggag
aaggacccGTTGGCTGCTTGGAATGAGCTGCACACGTGGACCAGCAACCGATTTGAGATTGATATTGAAGTGtacggagctggagagagCGCACATGGAA
CCGGCAAGACCCAGCAGAAGTGGATCTTGTACTTTGACAAGGTgcgcacgctgcagctgcagttcgctAATGAGAAGGACTATCGGTTGTATAACTGGCG
AGGAGAACTGACCACCCCCACCAATGTTCGACTGGTGGACACGGACTTTTACACTGGACCTGCACGCCTGGCGGTGGTTCCACAAGGAGCGTCGcaggct
gctgttgaagctctTGACAAGGCTTCAGCTATTTACCCCGTGGGGTCCTCGATCACGACGAATGTGGGCGACCGTGATGCTTCCTTTTcgttctgctgga
agacgaagcgGTTCCCTGATCTCGGAGAACCGAACCTGAAGTCGACTTCAACGGCTGAACTGTTGATGCTGGCAAACCCGCATCACGTAGCAACTTTCAA
GTCTGGCAGCGATGCTTTCCAGGTTGTCGGACAGTTTGGACACCGCACACTCAAGTCAAACATGACGGCGGTGCTCGGTAGCTGCTGGGAGATGCAGGAG
ACGTTGCCGACGGCTTCgttccaagaagaaaacgtgCAGATCCAGCCGCAATATCTGGAAGCGATCAAGGTTGCTCTGGCTAACGACTCCAACTACACTC
CAGAGGCCGACGATCCTTACTACTTTGGTAAGGAGATTGGTCGTCAAGCCCGTTTGGTTCTCATCGCCGACAAattcgacgagaagaagctccgtGACGA
GATGCTCGACAGGCTGGAAGAGTGGTTGACTCCGTGGATGCTTGGTCAGAACGTTGACCACTTCGTGTACGACCGCAGCTGGGGAGGTTTGTGT