Description :
From Genome Similarity Track
Location :
Scaffold_256:7428- 9284
Transcript NameFunction/comments
g14010.t1hypothetical protein

Sequence
1856 bases(100 bases per row)
AGTCGATGACATGTAACATCTGTGGTGCGTACGGTCATATCCGTACTGAGTGTGAGTCGGCGCCGAGTGGTGGAAGCAGGACGAGTTTCGGGAATACGGG
GCGTCCGTCTTCCAAGTGCTTCTTCTGCGAAGAAATCGGTCACGGTGTAGCTGCATGTCCTACGCTACGTTCTATGAAAGAGATGATGCCGCGGAATGGT
GGTTCCGTTTCGGTCCCTGGGCACGCGGGCAATAGCCAATGAAGGTGGCGTGAGGGAGGGGAGGAAAGAGTCAACCCTTCCTCTTGCCTGGTGAGTGGCT
CGAAGGACAAACGTGAAAGAAACGACGAAGTAAATGCGGTTGTCGAAGTAAAAGAGGAGGACGAGAACGGAACGGTCAAGGCGGGTACGGTTGAAATAAC
CCGGTCTGTTGAAAGAGAAGAGAGAATTACGAAGTCAATAGTAGAGGACGACGAGGGAGGTACTCCGACTATAGTGCCTGCGGAAGGAAAGATTGCCACA
GCTAGTAAGGGGACGGGGATGAACGTCTTACCGGCTACTGCTGTGAAGGAAACGAAAAGAGTGAATGTCGCGATTGAGACGACTACGGAAAGAGAAGTTA
CTCCGGTTGCTGGAAAGAAGAAATTTGAGAAGATGGCGGTTGACGAGAAGAAGGAAGTCGATCCCGTATTGGCCCGGACCGTGACGATCAGTAAAAAGAA
ACCAGTAGTCCGTCCTACAGTGCAGCCGAGGAGCATACTCCGAGTTGGGGGTCGTTTTTACGTGCCCCGTGATGAAGACGTTTGGTCAAGCGAGGAAGAA
GACTGGGACGACGGGTTTGATGACTTTGGGGAGACTCTTTTCTCGAAATGGACGCTTGAACCGGAGCGTGAGGAAGAACCATGTGCCTCGGTCACGGAGA
AGTCCAAGGACGAGGGGCTCTCGGAGAAGACGATTGATGCTGAAGAAGACGAGCCCAGGTATGCTCGACTCTTCACTGACTGCGAATTGGACGCTTTAGA
GGAATGTAAACCCGGTTCGGAAGCAACCGTCCTGGCTGGAACTGAGACTTTGCCGGAGGCGGAAGAATATGAAAAGGAGCTGGAAGACCGATTGTACCCT
CTGGACGAGGTGGAGATTAAACGTCGAATGAAGCAGAATGAAGACAGGGCAAAGGAACCGTCCCTGGGGGACATGGCCCGATATTTGGATATTCCGTTGG
ACGTCTTAGAACGGACGCGAACTGCTTCTCTGGATGGTACTACGTCTCCTGAGTATTGGCAGGACTGGTTCCGCGACACGCTTGAAAGCTCTGAGGAAGC
CAAAAGAGCAAACCGTGACTTCCGAAAAGCCGAAACTGTTCCTAGTGCGGTGGCGGCGAGCGCTGATAATGTCGAAGTGCATGAAGGCAAGGTGCCCATC
GCTGATGAAGGTGTAAGCTTGAAGAGCTCCGGAAGAGACGGCAACGAGGGAACCGTCGGAACCTATGTGGAAGAGCTGAACGAAAAGCTGACGGACGAGA
GGACGGTTCTCGAGAACGTATTACTGGTTACCGACGCTGAGGCGTCCAGTGCAGATGAATTTATGACCGGTCTACTAAATCGAAAGGTGGTAAACCCGGC
GGTGGTAAGGAAAATTGCTCGAGTCGCTGTTTACCGTTTATTGAAGGAAGAATTGGAGCGTGCGCGCGTTGAGATGCGAGGTTCAGTCCTTCCACCTGTG
GATGTCCCCCCTCTGAGGGATAAGATGCCTTGTTTGGATTTCGTGCGGCTACATTGGTACGCTGACCGTGTGTATGAAGAACTTGGTCTGGATGGGGATT
TTTGGATCCCTGTAATTTCTTACGCGAAGACCTACTTTGCTGACAACGGCTCGTCC