Description :
From Genome Similarity Track
Location :
Scaffold_150:74256- 77303
Sequence
3047 bases(100 bases per row)
CCTTCGTCTAAGTTACGGGGTTGCACGATGTAGTTCACTCCAGTCTGCGGGACTTTAGGATCTGCTCTCGTCATCCACTGTCGCTCTCGATCTCCATACT
CTCTTTATCCGCATAGATTTTTGTTTGAGCTAAAACTCATATTACAGCGCCAAACGGTTGAGTACGCTTGCTACTGGACTGCAGGCAGCATCCAGGAGAC
CGGCTCCATGATCACTAGGTTCGATGAGGAAGCGAAGTACGACTTGTACTACCGAGTACTTCGGAGTGTTTGGAGCGTGGGCACAACAGACTATGGCGAC
TCGTACTCATGGACTGGACTTCCTCCGGGTGCTTCCTGAGGTAGTAGAGTGCAAAGCTACCCCCTCGTGCGAAGAGCGTGGGCACTAGACAGTGAGTCCT
TCAGTACTATGTATTCGCGACGTGTACAAGCTCGCACAGGGGCAAATGCCTTGGCGGCTACATAACAACGAGCGAAGAAGAGCTATTGGAGACCACGCAA
CTATTATTTATCTTAGTCACATGCACAGGTAAGCAAGCTCATCTCGCGTTCTTGTGTACAGGTGAACGTGGCCCAACCATCTAAATCAAGATCCAGCGCA
ATCCAAACTTGGCCTAGTCCGAGGCGGATCACAAGTCCGCGCCCGAAGAGGGGTTGCCTGCACCAGAGCAACAGTAATTCGAGTAAGATGCAGTGCATGT
AGAGCGAGGCGCAATAGATCCGATGCCTGAAGACGTTGAGGTGATGCGGGACTGTACAGGAGCCGACGCCAGACGCGGAAAATGTGCAGCGTAGCATCTT
TTGGAGCTGGAGGACGGTGTTATGACCTTCAAGTAATAAATCTACTGCTATGACCATCCTACTTTCACATAGCCTTCGCGAAATTCATGCGAGTCCTTTA
AAAGAATCCTATCAAGCATCGACCGCCTTCGGATAAATAGCAGGGGTGCTCTTACTCGATGCATAAGCACAACAAGTACTCACATAGGCAACAGATATAC
CGAGTCAACTCGACATGTAATCTGTTGCAGGATTTCCGTACCGAAAACCTGTTGCTTTCGTCCCCTACACCACGCAACAGATAAACCGACTCGGGCAACA
GATTTTCCGCTGATTTGCCCGCAACAGATGAACCAGTAAATTAGCAACAGATAATAATTACTCCCCGACCCGGTAGAACTTGTAGCTGGCGTTCGTCAGT
CCCTCATCCACGGCCACAGGATCGTGTGGCTGCTATCCTCTCTGTCTTCTGCAATGCTCTCGGCCCACGCAAGTGACGTTATATTGAAGGCTCCCCCGAG
GTTGAGCCAACTACATATACCGCTGGACAACGATAAAGCTAATGGTCTTCCTGGCACAACGGGTTTAACTATTAGGTTTTATTTTAAACTTAAGTATAGT
CAAACCTGTCAACCTGCAAAAAGTGTCAATAGGTTTTACTGCGTATGGTGGTCAATTGGCCGAACAGTCTAAGGCGGGGAGTCACTGAATTTCAAATCGA
TTTCAGGTCGCAGAGAGAAAAAAAATTGGGGACCCGGGCAATGAGGCCCAGAGATTCGCAGTTCTCGACGAAAAGAAGAAAAGTGTGGAAGAAGGAGATG
CAGAGGCGAGCGCTCCTGCAGAGCTTCAGGGTTAAAAGTTAGGCATGGATGTTGCCCACGAAGAAAAAAAAAGAAACGCGAAGCAGGCGCACACTCGATG
TCTGGGAAGCACCAGGGTTGAGCTAGGGGACTTACGTAAAGGAAGTAGTGACTCGTCAACAAGGTCAAATACCAAGCACACAGCTGCATTTATTGACTTG
ATCAACTTCAGAACGATTGACCCATGGTTGCCTTGATTTTGGTTCTTATGCAGATCAGGTCCAGGATTTGAACATGCTGATTGTGAGACCGAATCAAAAG
ACCTGAACCAAACAGCCACAGCTTTGGATCATGGCATGACTGGGTTCCTTAGCGCGTGCTCCGCTCGGCTTCCTACTCTAGCAACAGTTCGTGGTGCTGT
ATCTACGTGAAAGGGTGTGCATTTTGGCCGGTTACCTTGGCTCGATAGGTATTTTGGCAGTAGATCGTGTTCAAAAGCATTGTATTCACTGCTTACATGG
ACTATCACCTACTACACTGTATCGGATAGGTAGAACGAGTCGCCGCAGCAGTCGAACATGCCTCCCTTTCCTACTTCTCTTGACAGCAAGATTCATTATC
TGCAATAGCACACGCTGTTCATGTTTCTAGTGGTGCTCAAAGTCCAATGCAGTTGCTGCAGTGCGTGCATTGTATCCCATTCGCGACTGGTGTTTTTTTA
GTCAAAGCAGTGCACACCTGGTTTGGTTTCCGTTCACACTCTCAGCATCAACTCTCCACTGTTGGCAATTAGCACATATCTTGTAAAATTAGTTTACCAA
CAAGTAGAAGGTACATGTACTTTAGAATTATGTAGCCTAGCTACGGCATGTGATCGACATGTTTCACTCCTGCTTGACTAGGAGAAATATATAGCGTTTC
AGCTCGTAGCGAGGTGCCACAGCCGCAGCACGGCAACAAACTCTCCAAAGCGAAGACGTTGCACTGCGACCAACCTTACCAGCAGACGGAGTAGCAGACG
GAGTAGCAGCAGCAGCAGCAGCGCGGCGACAGGACGTCCGACGCAGCCTCTTCCACTGTGCGCCCACCTCGTCGGGCTCCGCATCCTCATGCGTGGATCT
CAGGCACCACCTGACGCGCACCTGCGAGCGGGAGCCAAGCTCGCTCACGGTGACAGCCAAAGGTGCGCGTTTCCGCTCGACTCGGAGCCCAACGGCGGTG
GCAGCCTGAGCACGTGGCAGGAGTGGCGCACGGCGCAGCGGTCAGCTACGCCGACTTGGACAACAGGGCAGCAACGATGTATCCGGATACCTGCGTGGAC
TTGACGCGTCACTTTTCGCGTCCTCGCCCACCAAATAGTATAGCTTGCACAGCGCAGTATGGCCCATCGATTCCATAAGCCACTTCCTGGCCGACTACTG
CTTGTGCTCTTCTGACGCATCTTGCCCACCTGCTGCCCACTACGATG