Description :
From Genome Similarity Track
Location :
Scaffold_1002:7425- 11844
Transcript NameFunction/comments
Phyag_g9069hypothetical protein PHYSODRAFT_515366

Sequence
4419 bases(100 bases per row)
GTTTACCGTTCTACGAATATGCtcggcctccacctcctgtaCCTGGTGGACACTGGTAATCTTGTGGCAACATATAGTTCTGCAGCGCACTGAAACAATA
CTGTGCTTTGCCGATGTTTTTCCGCGCGTTCTCGCGGCGCACACCGTGCGTGCGGAGTAGGTTGGTAAATGCCTCTCCATCATCGGCAAGAAGTCCGTGT
GAACGGACAAGCAAGttcgcttcttccagcgtgATCGACATCGAAGTTCGGTCCTTGGCTGATTTGCACATCGAAACACGGCCTCCACCCACAGAACGCG
CAATAGATGAAGACAAACTTAAAATGGCCATGCGCTTGGATCGCCCTGAGAGTTGTATGTTGGCCTTGAGCGCTGTGAGCGATGTTTGAATCCGATCGAG
GTCCTCAGCATCGCAAATAGGACCCGAGGTGTCATCTCGGCACTTCTTTTTGGAGACCCATTCGGCGAACATGTTGACATACGCCTCCAACACAACCACG
TTCTCAACATTGATTTCCTTCTGAAGCGAGGCTGTCCCGACGGTGTTCGCAACTGTCTGCATCTCGTTCATGCCCTGCGAGAATATCACAGGTACTACTC
GAATGGGCTTCTGAAACAAAAACTTCGCACGCATCTTCTGCTCAGGAGTTGACAGCGACAAGTAAATAGCTCCTGACACAGCGTCTTGCCCTGGAACTCG
GTGCATGCTACGATCAGGAAAGTCACTTGCGCGACGTGTAATGATAGGGAGCTCGATCACGATACCTGATGGACCGGAAGTGATGGAGACACggaaagct
gcagcacgcggcGACTTCACAGGCCGTAACTTGATATGAACCCGTCCAAGCTCCTtgactgctgcttctgtgTCGCCGAGCATTCCCAGTTCGTTGCCGT
ACGTAGACAGCAAGCTTTCAACCGAAAACAAGAAGCCAACCCTCGTAAGCAATTCTAAATAGTCGATACCGCAGGCCTTTAGAGGATATGGCCCGAAATC
CCGGTGGTCGTGCGTGTGCACGTAAAGCGTTTGTTGAAAACACGTGACCAATGCGCTCATCGCCTGGCAGAACGCTACCTCAAGACGACGCTCCACGTCC
CATTGGAGCTCGATGTACTTACGCTCCAAAGCGTCCATTGTCAGATCGGAACTTGCTTGTGCTTCTTTCAGCGAACGTCTATTCAGTTTTTCCAACTCTT
CACGCATCTGACGCACGCCGCCGCTCTTAAACCCATACACGTGTGCCGCAAAGGCACCAACAGTCGTTGTACCATACATTCGGTGCTTGTAAAAGGGAGC
GTGGGGTCTTGCATTCGTATCAATCGTCATCGCTGCTTTCTTCAATTCCGCAGGGGAGATTGAGCTCTGTGACGAGGAGTAGCCTCCATTGCTTGGAATT
GCACGTTTCGTCTCGTCGCCATCTAAACCGCTTGAGAAAATATCGCCGATAACGTCGACTGCATCAGAAGAATCAACGTTATCATCTAGACCGTAGATGC
TCTGGAACTCTTCTTCGGTGATCCCCATCGCAACAATGGTTTCTGCCAGCTTCCGCTGCTCAGAAGGAACGGAAATACCCTGGCCCGCAGCTCCCTGGTT
GACAATAGTCTCCGCTGAATCAAATGAAATCACTCGCCGACGAAGTGCCTCCACAGGCTCGAGTGGCGATTCTTCGGATGAGGGCGCTGGTACGACTTCT
TTCTCGTCGTTAATATCGTCATCTATGAACTGAACGGAATCGAGATCAGCTTGCTGTCCACGTACGCTGGACTCTCTCGACAGGTTCAAGGGTGATGACA
TCATAGTTTCCACAAACGAATTCACAAGGCGTGCATAACGCGCCGCGCTAGTTTGGTCTCCATATTGGACATCTTTTTCTGATGTTGGAGCTGCATTTCC
CACAGTCATCAACTGTTGATGAAGATTTAACGCCAGAAAACGAAGATTAGCGTCCGCTTTCATAGTGCTTGGCTTAAATGTGAGCCCCTCATGTTGCGTG
GCTCCATATCGTAAAATTGAGTCTTCCACTTCGGATACATACTGCTTCATTGTCTTGACAAGATCCAAACGCCACTTGCGTTTTTTGCGCTCCATCACAT
CATCTTGGATCTGAATGATCATCTCTGAGAGCATTCCAATGCTGGTTGCCGGTCTAACTCGAGTCTCTGGTTGCAGAGAGGAGCTCAGCCCAGACGCAGC
CGATGGCAACGACTCCGAGTCATCGGCGTCTGACGCCTGTGTCGTGTACGTCATATCATTTTCCTGAACGGTACCAAGCGCTCTGGGAGTGGCAGGAAGC
ACTGACGGCACAGAATAGCCGCCAACACTTGGCGTTGATAGCTGGCTGGAGGGTGTTGATGACGAACtttcatcctcgtcctcaaGCGCAATTTCACGTT
TGAGGCAATCGAGTTTCACGAGCAAGTCTGACAGTATcagctgaagcagttgaTAAGGTACCTCCCATGTATACACACTCTCGatgagctcttcttcgac
cagcATTTTGCCATGCGTACGTTGGGAGGTAGACGCCAAGTTGATCATCTGCTGAGCTATCTCGGAATACGCTGAGTTGTCACGGGGCGAAGGATCCTCG
GAGTCAGTACTTTTACTTCCGATATACATGAATGACCGAGTGATGCGTTCAAGTCCATCAGTAGACATTCCAGCATGCAAACCCTTCACCTCCGCTTCGC
AGCGGATAACAATTTCACCCGACGATCGTGTCCGAGATAACGGAGAATACAACGAGAAAATAGAGGCCCGACCgaaagctggagctggcccCATCATAAA
TGATGAGAGGGGCACAAGCGGGTCGCCAACAAGCCATTGGCTATTTAGGTCTTCTAGCGTGTTCGGATTTCGAACCGAATACACTGAGGCGCGAAGCAGA
TCCTGTTGACGCATTTCAACGGACAACATCATATGAAAGCACGGGTCCTGTGAATGCGAGACCTCAGTCCGACCAACTTcagccagcaccacaccCGTCT
CCGCATTCATCAGGTGCAGAACAACGAACGACGACGAATTCACCAATGACTtggacggcagcgtcaaATTAAAGCACTGAAAAGAAAACCACGCGCTTAA
CGTCGGCGACACAGTCCGCGCTGACCATTTCGAGTCGCCGTCCCAAGATCCGTCAAAGAACGTTACCTGTTGTGCCTGTCGTTCATACTCAGCCGGTGAC
GGTAAACCTGCGCTGCGGGTGGAGTCGAGTCTAGATGACCTGTCGAGTGGCTGCTGTTCCTTATCTCCTCCGCCCAAATGTTGTCGCACCACAAGCTCCA
GTCGTCGTCTCGCCCGCTCCAAGACGCCGTTTCCAAGACCCAACGACAGCGGACTCGGTCGGCGTCCAGCCGTTAAATAGCCTCCCTGCAAACCAGTCGG
AGAGTTCGGGTTCGCTGCGCCGATTCCGTCAGAGTATCTCTTAGTCGCCACTAACAACGGTCGAGGTGGTTTGTCTTCATACTCCAACAACGGTGTCGTC
TCGGATGTGACTCGCCCATTATTGTAACTCAAACTGCGTCTTGACGGGATCTCCAACGTAGGTTCCACCTCCCACATGAGCACGAGGAACAGTGCACAAG
GCACAATCTCCGGAACTGCATACCCCACGATGACACACACATCCGCACTGTGGATATCTCCACAGCCTTGGTGCGAAAACGGCCGCTGGATGTAAATGAT
GGTGCGCAGTAGGAAGAGGACGGCACACGCGCCCATGACGACCATCGTGAAGCGCAGTGCGCGtgtgagcttcttctccacgcgtTCGTCCAGTCTTCGT
CTCAGTCCGTCGCCCGAGGGTCTCAAAACACGCGCCACACGTAGGCGCATCTTCCAGGTGGAGTAGAGTAGCCCCAGAGAGCTCACGAAGCTGCcggtgg
cgatgaagagcaccGGCATCACGCCTGTCCAGAGCGTGGAGCGGTTCAGTTGAGCATTGGCGTGTTTGGCTTCGGCCACTTTGgcctcgtgcagcacgga
gAGACCCAGCACCGTGGCGTAGAAGGCTCCGTTGGCCACGATGAAGGCCACCCAGATGCGTCTGGAGCGTCTCGAGACTTTGGGGTTGGCGATGTCGATC
CAGAAGAAGGTTTGGAAGAGCACgaggctgaagaagaggcACAGAGCGGCGCGATTGGCCAGATTGCGAGCGACGCCCTGGCTCAGGACGAAGGAGGCGG
CTCGAGTGAGGGCGAAAAGGACCATGAGGCGCTGGAAAGTGCTgcggtggaggcggtggaAGGCAGAGGTCGAGAGTTGCgattggctgctgctgctgtt
gctgttggagaGCAGAGAGAGCGCCCGGCAggcggccacgagcgccagaCTGAGGTACAAAGCCACACACAGAAGCTCCAGAGCTGAAGACGCTTGAGGC
AGGAAAACCAGGCCGTCGT