Description :
From Genome Similarity Track
Location :
Scaffold_1181:7424- 9853
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1181-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2429 bases(100 bases per row)
GCCAAGCCAGCGGCCGCCGTACGTTTGCTATTGTGGGTGAAGCGTGTATGTGTGTGTGTGGATACTGAGAGTGTGTGCGGGATTTCTATAGCCGCAGCTT
TCCAAGGAAGAGAAGGAGAAGCTCGCCGAAGAGGCCAAGGCCAAGGGTGCGTACTGGGAAAGCAAGGGGATTGTGGGGGGAAGGTCTGAGCTGGAGCCTC
TCTCTCTCTGTGCACAGGCAACGCGGCGCTGGGCAGCGGTGACTACGAGACCGCGGCGAAGCTCTACTCGTCGGCGATCGCGCACTCGTCGGACGGCTCG
AACTCTCACATTTACTATGCCAACTACGCCGCCGCGCTCATGTACTTGGGCCGCTACGACGAGGTCATTGACAATTGTGAAAAGTCGATTGCGCTCAAGC
CGTCGTACGTCAAGGCCTACTCGCGCATGGGCAATGCCCAGGTCCACTTGAAGAAGTACGACGACGCGATTGACTCGTTCCGTCGCGGTCTCGAGGTCGA
TGCGTCCAACGCGGCCTGCCGCGACGGCCTCGCCGAAGCGGAACGCAAGCAGCGGCAGATGCAGACGTCGTCGTCCTCCACGCCGGCCGCCGCGCGTGGC
GCTGGTGCGGGCGGTATGCCGGATCTGAGCAGTCTCGCGGGCATGTTTGGCGGAGCCGGTGGCGGCGGCGGTGGCGGGCTTGCCGATCTGCTAAGCAACC
CGGCGATGCAGCAAATGGCGGCGAGTATGATGCAGAACCCGGCTATGATGCAAATGTGCGTTGTTGGATCTCTCTTGGGGCGTGGTCACGAGACTGACGG
GCTGTATGGTTGCTATCGTGTAGGGCCCAGAACATGATGCAGAACCCCGAGGCGCTAAGTGGGTTAATGGGCAACCTCGGCGGCGGCGGTGGCGGTGATG
GTGGCATGCCCGACATGGCCGGTATGGCCAATGCGTTCCGCAACAGCCCGGAGCTCATGGCGGCGCGTAGCGACCCGGACCTCCAAGACTTTTTCCGTGA
CGTTGATCAGGAAGGCCCCTCGGCGGCCATGCGCCACATGTCGAACCCCAAGGTTTCGCAGCTCATCCAGAATGCCATGGGGGGCATGGAAGGCTAACGC
AATTTACGTAGACAGCAACAGTAGACTCTCCGCCACTCGCATCTCAAGGTGACTGACTGACTGTAATGGCACCACGACACTGGTTTTTTATGCTGCTTTG
CTTTGCTCGCTCGAAAGTCTAAAGAGAACTTGGCCTCTCTACCTGAAAGAGCTCTTGCGACCGGTGTACCCTAATGTGATATTGTGACTACAGAATACCA
ATATAAATCGAGTGGTTTGAAGAAAATGAGCCCATGGACCTACGTACTGGTTCTCGGCGAGCAAGGTCTTCTTCACCGGATCCGCGAACGGTTGCGACAA
GTGATGCTCTGGGCGGCTGCAGCATTCGCACGGCATGAGAGTCAGGCTTCTCCTCCACCTTCGAGCTCATGACGAGGCCACGAGTGCGTACATCAATTTA
TCCCCAGTATCTTCAGCTGCGACGAGCTTGCCGATGCCTGCAAGCAGAGACTTTCGCGGTTCCAAGCGCCGCCCCGACAGCGAGCCGCTACTACTGCTGC
CCGCGAGTCCAGCTGGCGAGTTGGCTCGTAAATTGCCAGTGTTGCTGGCATTGTTGTCGAGTGAAGACGAACAGGCACGACTGAATCCGGCACTCGTGGG
TTTCTCATACTAGGCACAAGCGTCAGAGACAGCTCGACTCTCACGCCGGGAAACTGTTATGCGTACCATCGGGGTGACGTGGCGTTTGTGCTGCGAGTTC
TGGCGTGTGCCGATCGCGTACACATCCTTAGGCGTCGCCTCCAGCGATGTCTGTGATTCGTACGATCTTCAGACATGGTACACATGAAGACTATCAGAAA
CTCCAACATCTCAGGTTATATGCCGCCTCTCCTCACGTCTTCCAGTTGTTGCAACTGAGGTCGGCACCCGGACCGACTTGGTACACGGCGCTCTGGAATT
TGATGCCCAGCCGCGTCTATGAAAGCCAAAGGATTTGTTAGTCGAGATCCTCTCCAGTTCCTCATCTACACCACGGCTTTACCGCATCGCTATCCGGCAG
TTGATTCTGGTCAAGAAGTTTCTTGCCCGAGAAGCTGGACGGTGCTATGGCAGCGTCCGTGTCGGGCATGATGCCGCCCTTGGCGTCGACTGTGAGATTC
TGCCGCGTCGCCGTGTGGTCGCTATACTGTGCCTTCTTCTTGTAGCTGCGATACACGAAGCCACCCCAGTCGGCGTCCGGATGCGCGGGATCATACCTCT
CCTTCAGGTGGGGGACGACGGGCTCACTGGTATTGTTACTCATGCCGCGTGCTTTTGTATAGCTGTCATCGAATCGACCCGCCTCGCTGCCTGGGTGTTG
CAGGATGCTCTTCATTCGTTGTTGATCAC