Description :
From Genome Similarity Track
Location :
Scaffold_338:7424- 9131
Sequence
1707 bases(100 bases per row)
TACAAAACTCCGCGAGACTTAAAGTGAAGTGATCCACCACTTTTGGCCACTTCTCAGGTTCGACTGACTACAGCTCTTCCAAGTCACCCATCAAGTAGGT
TCTGAGTTTCCAGGTTCAGGGCTCGGCCTCTTGCTGGGACAAGATTCGACACCACCGTTCGAAACTCGGCGCAGCAGACGTTGGCTCATCCGGCGCAtaa
gcttcagctgcagaAATTTTTGGACGCGGAGGTGTGCCGACTTCATCGATTCCTTCTGCGGAGCCTCTGGCGCGAGCGTGGTTCCGAGTCACTACAAAAA
TCTTGACGATCGGGGCCATTGGCTCAGCTACTGCTTCCACCGATAACCTTTCCGCTACCGCGTCTCTGGTATCACGATCTTGCGACTgatgtaacggggt
tacacgtacaagtggctacatcacttgtaacctaacagaagtggcttctgttagaaattagttacctccttccttggtgtgaggcacaccaatggctgCA
TTTAGCCGGACGACTGGTNtaagtcaaagaaacctacgcttcctcatacacgtgcgcacacgtgtaagcttaagattgggctaagtaggcccattacaac
TTATCCCTTCCTGACGCCTGGTTCggtcatcttcatcaattTCTCGGGAATCCGGTTCAGCTGTTTCAGCTGGGCCAGTTCAATCGGGACATCAATCACA
ACCGGGCCTTGAGCCATCAACATATTGGTCGTGTGATAGTCAACTGCGGCGTTATATTCACGCTTGTCATGCAGGAGCTTCAGCGATCAGAACTTCGGGC
GGATAATCTGGAACTCGTTAAGCCGCAGTTGCAGCCCAGGCTTCAGACATTGAATCAAGTCTTGAGCTTAATCTCCTACCATCACCAATTCCGGAATTCC
AAGGGTACGTACAACCTGGCATCCCTCGACCAGACCATGATACTCAGCCTCGTTCACCGCGATAAGTTCGACGTGAAACCCTCGAGGCCCCAAGACGGGA
GTTTCCACAAGACACATCCAAAACTGCCTCGCCGATCTGAGAGTTTGGCAACTCCGTCGAAATTGAGTAGCCACTCTTCGTAGCCAGCTCCAAGTATCTC
CAGAGTGATTGGCAGGACTTGGACAACTCGGCCATGGCTGGAATTAGATTTTGTGCAACCTTTTCAAGTTGTTCTCGTGGAGTGATCCCAGCACCCAGGG
TTGCAGCCAAACCACCCTCATCCGACTTGAACTTATGAATCTCGAGGGGCCAGGGCGCTAGTTGCGCTGCTCATAGCTCACACCGTCCTTCCAGCGACTG
AGATCTGAAGATCCAGGTCAGCACCGAGTAACGCGTGTACACTTTCAGCAACCTGCTGTCGGGTAGGCATTTACTCGGGCAACATCCACAATTGCCATTC
TTATACCATTTTTTGGAAGTATGACCGTCAGCTAACGAGAACCGCCCCCGCAATTGGTCGAGTCTATCAACGCCTGTATGTTGGCGTTGTACTGAGCAAC
GCACATCGGTGTATCCAAAGGCTGCATATGACTACCGATTCGCCGTATTAGTGCCGCCTCAGTCGACTTGTCCGCGTTCGACACCATTTTGACCACCACG
CTGACATACCAAGACACTACAATCATTTCATGCGTCACTGAAACTCCTTGTCGATACTGTCCGCGGCGGCACTCTTGCTTTTGAGGACAACATGATGAGG
AAAATGC