Description :
From Genome Similarity Track
Location :
Scaffold_709:7422- 15407
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_709-snap-gene-0.4GK22865

Sequence
7985 bases(100 bases per row)
TCCAACTATGAATTGAACCATCTCTTGGGCTTCTGCGACTTGATGCGACTATAAAGCGCTGTTGCCCGACGTCCACGTTTCGAGATCGTGAGTGCGCTGA
GAGCCGAGTTAGTGGATCGATCCGTGCTTGGGGCCTTCCACGAGTCCAGCAACGAATAGCGGCGATCCGAGTTATACTCGCTCGGAGTACCCAGGCTACT
CATAGGAACAGTGTCTCCGTTTTGTGCGCCTGGTTGATACGCCTTGCTTGGTGGTGGAGGTAGACCTTCAATCACGCGCATATCGGGCATGCTATCGCGG
TGAGCACGGATTTCGTCGATATCGATGCCATATTCCATTGCTTTTCCCGCATGATAGTTGGTTTCTTCAGGTTCATACCTTGCGCGAAGTGTTGACGTTC
GAAGTAGTCTTGGGGATGGCAATGGTGAAGGATTAGATTCGTTGCCTTTAAACCGGAAACTTCGAGGTCCAAACGCGTCAACGACTTCAACTTTTTCACC
ATCAAAGTTGATACTCTTGGGTGGGGCTTGAATTCGTCGGCTTTCTTGCTCGCGTTCGTCATCAACGACAAACGTACCGACAAAGGTGTTTATGTCATCT
CGCTCGCCATCAACATCAAAGCTTTGCATACTCACAGGTATCTGGTGATAGTACTCGTCCCCATTTTGAGTTCCATACATGCTGTTTGCAAAGCTTCGAT
TGTCACTGTCTGGGATCTTCTTGGACAGCTTTTTTTCGGACAAAGTGGCGTTCAGCCACCGAGCGCTCTTTCTCTCTATGAAGGTGGAAGCAATAAAGCT
TTCATCTCGAGATCGCTCTGATTTCACTATGCGAAGAACACGGTTTGCATTGCTCACGACGGCAGCATCCGTAACTTGTTTGTCTTCCACAAGAGCTTCT
AAGAATTTAACCATTTCCGCGTAGTACCTCAAATCGCGAAGCAGGTAGTCGGGCTCCGTTTTCGCTGCACCATCTGCTGGTGGCGCATTTCGAGCTTCTA
AGACTCGACGCACTAGTTTTAAAAGAGCAGGAATATCAGAATGCTGGAGGGTAATTCGGCAAATGATCAATTCCAAGAATTCGCGAGACACCATTTCTGG
AAATTGAAGCAATTGGCGCGCGAGACGAAGCACGCAACGATACGGGAAACTAGTCACCAAATACTTGTTACAGTGGCGTACCAGCTTCACAATTTGGTCT
GGTATTTGGCTGTTTGCGATGCTCTCATCGATATTGAGCGGAGCTCGCAAGATGTACGTGATTGCAGTCGTCAATCTCTCCACTTCGTCGACAGTTACCT
TGAGCTCTTCTGGTGACTTCTGAGCGTCAAAATCAACGAGAGTATCCCACTCAGTACGCCAAAGCTGGAATAGAAGCTCAAGGTTGTGAGCAGGGTTCGT
CAGCGCCTCAGGATCAGGACGCGACAAGAATCGATCCAGGTATAATCCAGCCACGAAATTATCAGGATAGCGCACAAAGTCAGTTGTGTCATTCAGAATG
ACGGAGTCCCGCTTGACAAGAGAGCGCTCTACCCGATTTCTGCAGATGATTTCATCGAGCTTCTTTCGAACTTCAGTTCGCCAGTGCGAATTCCAAATCA
AATCACTTTTCTCGTGGTTGTCATCGAAGAACTTGCTGGCTTTCGTGTGGTCTAGATGGATTTGATAGACGACGGGGTACGGTAGGAATCGACAGAGACC
ACTGTACATTCTCTCTCGCAACGAGAAATCTTTCTCGAACAATGCGTACAGTATCTCAAACGCTGGCCCTCGCAATGCTTCAGCTCGGAGGAAGTTTTCG
TGGAGCACTTGTTGTTTGGATTGAAGCGCAACACCTAGCACTTCAACCCACAGGCCGCTTCTCTCGACGTACTCAGCAATGCTGAGGCAGGTATCACAAA
GCTCTGCCAAGCACGAAAGAGCATAGTATGCTTGGTCGTAGCCCAAGTGGTCCGTGATAACTTGCAAACTCCACGTGAACTGGCAAAACGGAACAAGCAT
CTTCTCCAAGCTGCACTGGAACCCACAAATCTTGTTCAGGATAAGCAGCGCAAGCTCTTGGCGAATTAAATACTCCGTGTTGCCGAATTCAGCTTCCATT
CCGGCTGGGATCCCATCAGTGTTGCCTTTCTTGTTGAACCCGTACGCAGACAGAGAGCGACGAGACGAAATCGAATACCCTTTTTGCTCAGCAGCTTTGT
CAAAAGGTAGTAAATATCGGCCCAAGGTAGCAACAGAAATGGATGCATTGACAGGATCTAAGTCATCGACATGTTGCTCCAAGCACTCGACGAATGATGT
CGTAAAAGCTGGGATATCTGCCAAAACGCTCAAGCATTCGAGGGCTGGCTGCGTGTCATTGTAAAGGCCCAAGGCTGGATCTCGGTTCTCGTTCAAGAAG
ATAAATAACGCTTCCAGGAACAATCTTGCAGATGCCGCGTCCAAATAGATCCTAGTTATTGAATCTGGATCAATCTGTGCTTTTTCGAGGAGAATGCTCA
AAAAGATACCCCCAACAACTGGCTCATCCTTCAAACAGTCGTACATGTAGTTGATGGCACTCTCCAAGAAGGACAATTCGTCACTGTTGGTATCGGTGCA
ATACTCTTCAATCAACTGCATCAACTCAAATCGCATGCTCTCGTTCCAAATGCATGTTGGTTCACGGACCTCAGAAAACAGCATCTCGCAAAACTCTCGC
CCGTTTGGTCTTTCCAAATAATCTAGAAAGTCAAGCGGGAGTAGGTTCGCCAGCGCATCCAAAGCTTTCGATCGGCTGTTTCCACTCAGCCCAACAGCGA
TGGCTCTTAATGCAAGAAAAGCACTTTCCAGCGTTTCGCGCTCTTTCTTATGCTGCGCTACGCCAGTGTCACCATATCGATACGCGCTTGAATCCTCGCC
AGAAGTCAGCATCAGGTACAATCCTTTCCAAAAGACTCTCGTCATCTCCACTATCTGGGTCTGAAGCTCGCGAGATCGGCAAAGAGCAGAAATGATGTCA
AACGAGATCTTTTGAAGCTGCCACGGTTGGATGTTTTCAAAAGACAGCATCAATCGATCGACCAGCACGTAAATCCGCTCAGCATGCTTGTACTTGGACA
TATCACCTTGAGAATTATACTCAGCCGCAGTAAAAAATGTCGAAACATCGTCATCCTCCTCTCCTGTTCCAAAGTCAAACTGACTACCTGGCGGTGCTGA
GACTTGATTCTCGCCTGCGAATCCATCACATAAGGACCTTATCCCATCATCAGACGACAGAATAAACAGCAAAATTGAGAAAATGTCTTCTTTCGCTTCA
ACATTCCGGCTGAAAGCATGATACTCGATGGCATCAAGGAAAATTTCCCAGAAGTCATCCACTCGAAGAAGCAGCGCAACATTCTTTGGTGCAGACGAGA
GCAACTCCAGAAGAATTTTTCTTGATATCTCTTGGAAGTCTGGTACGTCGTTTTGTACTTGAACGCCATCGGAATCAAGCGGAGGTGCAAGCATGTTTAT
GAGCAAGTCAAGTGTTTTCGACTCGAATGAGAAGAACTGGAACTTGAACTTTTCCAGAAGCATCAGCTGTGCTTTCAGAATGCAATCGATAACTTCGTCT
GCTGTCCGTCCAAGATCCATCTCATCCTTCCTTTCAAGGCGACCACTCAAAGTATCAAATGCACTGCGCACCGTCGTCACTTCCACATTCTTCGTGCATA
ACTCTCGGTATCTAGCGCGCAAGTCAGCCAGATTGTACACCATGTCTTCACTCCAGCAAAACACTTTGAAAGCACCAGAATCATCCAAAGAATCGAGCCC
TCGTGCTTGACGTCGAATCAAGTAGCGCCACTTCTCCTCAATGCTACCCATCAGAATCAACGGTTGCTCAATTGCATCAATTTCCGCCTCAGACTCAATC
AACGTTGACAAGTAGTACCCGCTACAATACACGTCGTGTGATAGCTCCGAGTAGGTCACAGGCGGGATCGGTACGTAGTGATACGTTGCACCAACATCGC
GCTCCAATTCTTCTTTGAAGTCTTCAATGTGTTCTTGAATCATCAGCTGCAAATGTTGTCGCATAGTCGCAGACCATAACACGCGCTTGTCACTCTTCCG
GCAAGTGTATATGTCCGCAAAATTTTCAGCTGAATCCGTATCCAGGATCGTTATCAATGATTCTGGAAGTAAATCCAGCAGGTAACTTTGACCTATGTAC
CGTTCTTCAGACTTCTGTGTCCGGTGAATCTTCTTCATCAACTTTGCTTCGTAAACGAAACTTTTTTCTTCGTCGTTTTTGCAAACAGCGTCTGCAGCGA
AGATGAAGAAAAATGTGCCGAACGAGTACAGCTTCTCGAGATTTGAATCACTCAGCGTCATCAGTATTTCACACACCAGCTTTCGGACAACCGCATCTTC
AACCAAAAGGAGTTGAGCAAGCATAGCAACAGAGGAGGCATCAGACAGCACGCTGTTCGCAAGTGGTAGTGGCCACACATTCGCGGCCGTCGACGACACG
ATTTTCTCGTTGAAGACAAAGTTTCTCAAGATCCCCAGTGAGTACGTTGTAGTTTCGTAAAGATCGATTGACTGATCTGGCAACTCCATCCACCGCAGCT
CAGGGAATTCAGCGAGAGTGTTCCATGTGTGTGAACCAGGATGCTCGGCGTGCTTGGAGCAACAGCACAGATACACACCAAAACTGTTTTGGCGTCTACT
TGTGGTATCTTTTTCGAGATACTCCTTCAGCTCGACCACTGTAAATGGCCCTCCAATCGCTGCGTCGGTTTCCGAGTTACCAATGATATGCTTCGCACTC
CATTTTAGGTTAAAACGCGAGTTGCCAGCGAACGACATCCCAGCTATGTGTAGGGAGGACGTATTATCATCATTAAGCTCCATGAGCGGGATATCTTCGT
CAGTCACAGGGACGCTCTCGTCGCCAGCCTTTGATACTGATGGATCTTGAAGCTTTCGACGATGGCATAGTGTCGCAAGGAACAGGAAAAGCTGGACATT
CCGCTTTGAGCAGAACTGCTCGGTTGCTTCGTTCGCGAAACTCATTTGAAACATCAACTCCACAATATCTTGAATCTCCGCTGCTACAAACGAGTTGTTC
AAAAGCTGAACGAGGAACTTGGCGCGATTACGTGACACTCCGCGAACGCTCGGGAACACACGGGCAATTTCAATCAAAATCTTCAGCATCCAATAGCAGC
TTTCTTCTGAGTCATTGCTCTTTGACCAGTACTCGGATACATCTGAGAGACTCCCAGGTGCTCCAAAGGCTCCGTAATGCACGAGGCTTCCAAGATGCAA
GTTCTCAAGCCAACACTGGTAAACCTCATTGAAAAAGACCAATGGAGATTTGGCAATTTCTGCACTGGCATAAAACAAATCAGCTGACTCCTTGGATATC
TTCTTTCGAGCTGCATGCCCATTCGATCCGACAGTTTCTAAACCGTCGACAACCTCGTCAAACTGAAGCGACCCATCCTTGATTTTCTCGAGGATTACTC
GGAGATAGAATCGTCCAGCTCGTGGTTCTTTCGTGAGGCACTCATACTCGACGCGGAATTGCTTGTGGTTCCATTTTGGTTCAATTGCAGTTTTTCGCGT
TAACCCCGCGGATTGCTGGGAGCTGGGTACAGCTGGTATGTTTGCTTTCCATTTGTCAAAAGATTCAATGGCTGACTCAAGCGCGGTCTTCAGCTCGGCA
CGTGCTTCAGCATTCCAAATTAAATCTGGTAGCATGAAGTCTTTGTGCACTAGATTTGAAAGCAGCGCCAGATCACTTGGTGATTCTCCCGGGTAATTCA
TCCTGCTGTTATCCTCCTTCGCTTTGACGACATTTCCACTGCTTTCTGGTTGAACGGACGCAATGTGCTGCTGCATTCGCTTAATAAACCAATTTGAGAA
ATTGCTGATTGTCGTGCCTTTTTTGGTTCTGGGGCTCTTGTACTTCATGTCGGTCTTCAATTGTCGATCTTGTTCTTTTTGAAGTTTTTTTCGCGTGAGC
GGATGCGAAATCATTCGAAGAAAACCGCAAGGCAGCACCCGCACGAGCATTTCGTAGGATGCCTTATGATGAAGAATCCATATTGATCCGATGTACTGGT
ACACTTCACGCCCCTCCTTGTTTGAATGGAAGAAAGCTTTGTAAACGTCTTGCACGGTTTGCCCTGTCTCTAGAGCTCCATCACAGATGCGCTGCCGAAC
TTTAGAGTCTCCATGTTCCAGAACCAACTTCAAGATCGAAATCGCAGCGACGGTCAATCCGGTATTCACGTGTTGTCTTGAGAGCTCCATAAGCAGGGAA
AATTGCGAGCTCAAAGCCTTGATGATCGCATCGAAGTGATTGTTGTCCGTACTCTGGCGTGACAAAGCCAAAGCATCAACAAAAAGATGCAGAACCGCAA
GCAAGCAATATGGCCTTTGACTGCTCAACACATCCACGAGGTACTGTATCATCTTTTTGTGTTCAAATACTTGATGACGGTTTTTCTTCTCAGCAGTCTT
GTTCACAGGTAACCGTGAATGGTCAACGATAATCGAGTGCAATGCAGTCACAGCCCAAAGGATGGGGATAGATTCACCAGACTGTAGAAGCTTCGCCAGG
ATCGATATGATTGCTGCTGTATCCGAGCTTTGATCAGATCCGAGCTTGTAACAACCATCGTTGATTCTGCAAAATGCGTCCAGAACAATCGCGACTTCAT
TCACTCGCACAGGTGGCTTGCTCGATTGCTCCAGCTGAACATGCACACCACATACACACTAGGTTATTTACCAATTATCAAGCACAAGCGATTTGAGACT
GCACTTACCAATTTCGTCATTCCGCGCATGATCGATCCAAAAGATAGCTGAGACACTCGACTATGCTGAGCCTTCCCTGAGAAATCATCCGCTCGAACGT
TCATGTTCATGTTTTCAAGTGCAAACATGATTTTATCTGGGACTGCCAAGCCATCGTCTTTGGAGTTTTCGATTTCTTTCGTGAGCTCACCGTGCGCTGG
AATGTACAGCCCTTCATGGTTCAAGTAATAGAACCGCTCTTGGTCATCCAAAAGCAGCGCCCGCGGAGTCATTCGGACGTTGATTTTTGAGAATTCGCAG
CCCAACGAAACTCCCCAGTTGTTCGCAAATCGATACCCATCGTACAAAACGCCTAAAAATGCGTCTGGATCTGATGGAGCGTAGACCACTCGAGAACCAT
CGCTGAAATCCAACGCGATGATAGCTTCCATGCTTTCTATCTCGCGTCGGGGTGTCACAACACGACGAAGGCTATTGAGGGGGTACACTTTTTCGGAAGT
ACTGTCCACCTCTCGGATGTTTCCATCGACGATGCACACTTTTTTCCGACGATACCGAGACGATCCGTATCTGCTAGTTCGTTTTTGGACGTCGAGCCAA
GTGAATGAGTCCAGACTGTCTTGGTCAATAAGCCTTCTCATTTGTTGCTGCGGAAGTTGGTCACATGTGACAGATGGTATGTGTATGCTGATTGCACCTG
CGAGATCTTTGATCTTCTGAATGATGACCTTGGACTGCTCTGAAATCAGATACTTCATCTTTTTCTTGATTGACAAGACGAACGAATCTGGAGCACCGGA
TGCCGTTGTTATTTCTTCGATCGATCGGAATTCGTATTCGTGAGTTTGTCGATTCATCACGCGGACAATAATGAGTGCTCTCGGTGTGAGATAGAAATCG
CATTTTTCACGCTGGCCATTTGATGTGCTCAGGATCCCACTGAATTGATAGCACTCGACATGGTACACTCGCTTGAAGTCATCGAAGTTTCCAAGCATAT
GACTCATTAGCTCTTGTAGAAAAACGTTACGACAGCGATAGCGAAGCCTCAAAAACACCGGATCGTCGTACTCGTCCAACTTCTTCTTCAGTGACCCACA
CGACGACTCAATAAAAAGACGATACTGGCGCAACAAGACTTCTGGATTCTGGACAGCGACACCGCCAACGCCACCACCACCACCA