Description :
From Genome Similarity Track
Location :
Scaffold_440:7422- 10113
Sequence
2691 bases(100 bases per row)
CTTGGAGGCACTAGCTCGAAGGACATTCATACTGGGCAACCGACGTGCTCTATGAGCCCAGCGAGTTTACGTGCTGTCATTTTAGCCTCACTATCGCCCA
GGTATAGAAAAATCGGGACTATTATCTGCGTGGGTACAGAGGCACCTCATGCTTGTTCCGCCACGGCCTGGTAATAGTAAATAGACATTGCTTCTCAGAT
TGGGTATCTCTCTCTGAGAGCATCTCTTTCGGCAATGTCGTTAGATGTCGTAGACTCGCGCCCTGTGGGCCGAGTGGTCCAAGGCTACCCGCGAACTTTC
GTAACAACTTATTAACTACCAAAGGCTTGAAATTGTAGCACGAACGCGCATCGGTAATAGCTAATGTCTGGGATATACATCTAGACCTCTCATTCCCTCG
ATATGCTGCTGTTTTTCATCATCGAGCTTGTTGGTGATAATCGGTTCATCAAGACTAATTGAAGCACGCAGCGTTGTTAGCTCTCGAGCTGTACTTTGCG
CAGGAAAGAGACACGGCACTATACACGAGGGTTTGCGCGATGCAGACGTTACATGCTCGGGATCTTCACCTTCTGCTGCGCCAGTGTCTCTTTCATAATC
GACGATGTTCTCTTCTTGCAGGATGGCTTCCACAGACTCAGAGGAATGCGAGGACGTCTCCATTGATGCGCAAGGTGACGTCAACACAACCGTTAGGTCA
TATGCTCTCTCCGAGCTACTCAATGAGAAAGGTGAAGAATTTCGAGTCAAGGTATCGACTGTTTGGTGGGGGAGGGCGTATCGGATCACACAAACGGTTG
TGATAACCAAGTACGCAGGTATGATACGCACATAAAGAGATCAGCAAGACTGATAGGCGTATTATTGTATCACATACGCTAGCTGTAATACCGTACCTTA
TCGATTACGGATAGATGGTATCCATCGTAGTAGGGTTTTGATAGTACGGCGTAGCTCTGGTGTGGTAACACCAGAAGAACCCTCAATAGGACTACTCGAT
TAGGTAGCATAGTTTCAAGGTTAAATACACAAGTGAGGTTTATTATAGCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTTAATAGACTAAGAGACTCTACGAGTCTATAAATCT
TCCTCTGACTAAGGAATAATGGTATTCCCTATTACAGAATATCCTTCAAATGGGACAGCCACAGCAAGGTTACTGGTTCGGCGGACACCAAATCGTATAG
TTCGCCTCGCAACTAGGAGGTTATGACTTTCACCGTTGCACATAGCAACCGTCGCCTCTTAGGTTGCAGGATGTAACTGGCAGTAATTCTTTGAGCAGTG
GTTTGACGGGCGCATCCTCGGCATTTTGCTAAGTGAGTTGGCCGATCAACCGGTCAATTTTCATAATACCAGTATTATAACCAGCAAATTAAAATTCAGC
TGATGCAAGGCGGTCATCACGGCGCTTAGCAGCTTGAGCTGCCGACGACTCAAGCGGGTAAATAAAATTAGGTAACGAGTCAATAGCTTGATAGTACTAT
GCGAGGAAGACCTTTGAACCATCCTCGCTTTTTAGATTGGTGGATCTACAGTGGCCTCTTCGGTAGTAGTGCGCCAAATTTCCTAATCTAGCGTTGAGGT
TAGCATATTGTAATAGCCAAGATAGAACTGAATACTGCGTGAGCACTGTGACCTCGCCTGAGAACAGCATAGCATAAAAATATCTAGAATCCGTAGAGGA
TCTGATACATCTTTCTAGACCATCCCGTAATTAGCTTCGCCAGACTTCAGCATAAGATTAGAGAAATCGTTAGGCCAATATGAACCATCATTTTCCTTAA
GTTATTTAACAGATATCGCTAATCTACTTGCCTACACCATGATCACAAGTGATCGAAATGGATCAAAATGATTAAAAACGGTAATGTGGCTCCTTCATCC
TTTTTAGGTACGTAAATTTGATCACTACATTCTCTCATTGAATTCTTCCTCCGAATTTCTGATGGACCCCTGCATTTAAGTCCAGATTGAGTTAATTTTC
ATCTCCGAAATTGCGACGCAATCCAGATAGAATTCCGAGCGTTACTTGCGCGGCTAATCTCATGGAAATCAGCTTCACGCATATCATATAGCACGGACAC
ATAAATTGCGACATACTTAATAAATTCACTGTAGTAATTCAAACTGCTTCAAAATAAATGTATCGTTCCACACGTCCGAGAAAAATAAGCT