Description :
From Genome Similarity Track
Location :
Scaffold_5:742173- 757295
Transcript NameFunction/comments
Phyci_580405Hypothetical protein
Phyci_61754Hypothetical protein
Phyci_138386Hypothetical protein
Phyci_137557Hypothetical protein
Phyci_1654Hypothetical protein
Phyci_89778Hypothetical protein
Phyci_209258M96 mating-specific protein family

Sequence
15122 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCTGAGGTCGTCGCTGCACTGCGTGCGTCCGAAGTGGCGGAGGCTTGGACGGACGATGCTGACGGGGCGGTGGGCGTCGGAACGCTGGGCTGC
GTGAGCCGCCGTCGCGAGCGTGAGACCCGAGCGGGATCGCGGAGGCGAGGGCCGCTGCGGCTACCACCGCTTCTTTGTGGACGACAAGCCGCCTCTTCTG
GCGGCGAACCTCAGCGAGCTCGGCGGCGGTGCGCTTGCGCTCCGCGAGCCGGGTGCTTGCACGGGCGAGTGGGGCAGTCTCGCCAGGCCGAGCCTCCGCG
GGTGCTGGCGTAGCTGGGGCCGGTACCGGAGTCGACGGGGTCTTGGGCGCGGGCACTTCCGTCGTGCTGCTGCCAACTGCGGCTGCTGCTGCTGGGGGTG
GACTGGGCGCCGGAGTTGGGGATGGGGCTGCTCCGGGCGAGAGAGGGGCAGCAGTCGTTGGTGGCGCCGAGGGAGGGGAGGCCATGGTGGTTGCGGGGGC
TTCTAAACTTCGGTGGCTGGGGTGCAGAGCGCGAATGGGCGGCATCCTTGGCCTCCGGCTGCCGCCGGTGGTTTCGCCTTCGCGTCTGAGCACCCAAACT
TGGAAACCCCCGTTTCATTATCCTGAAACCCAGATTAGTGAGCTTGACGACCATAGAAGGTGGCGTGTCCCCACTAGCACGCTCTCGAGATGGTGCACGC
AGTATTGCCCAGCACCAAGTTGCTGGGCGCTCGCATGTAGGCGAGGTCGTACGTTTGGACCTCGTCGTCGAGCCGTACCAGCGACACATGGTCCTCTATA
GCGCCGCAGCACTTGCGCAGCGCAAAGGTAAGTCTGCCAGCGTCTTGAGTGCGGTCGAAACGGAGATTTTTATGGATCACGCTCATGCTAGGGCAAAATA
AATTTGATGTTCTCGCCACCCAGTTGCTCTCTTGGAAGCCGAGGCCACCGTGGCTTCCTCAAGTTAAGTCCAATTGCTGCCAATGAAGCTGGCTAGTGAC
GTGTGTCCTGATCTACATCTGCCTGCTTACCAGCGGAGCTCTCAGCAAtagagatatttcgcagcctgcagctcccatcacaacaacagcaaagagcgtg
tcacgggttcaaagcaagataacggcaagcagcgaggtgatagtgtgaatcaccatggacaccaactacaaagtatcgaacccatggcgtatgcctgggc
aggtatcagatgggagcaagattaggagtgtagccaatctatagcgagcctagtagtttgatgaggttttagtatgaggaaagtaaggatgcgagagatg
aagttgaagtgctggcgaagcacgacagcttcacctctctcattccggaatcaaccacaatggatttaactcgggttcctatttgctgctttgatcaagc
agcttcatgtggctctccacgacctcgacaaactgagcgagaggccccacgactaaataactacaaccaacgacctcacttactctgaaagtgctaccaa
atcgcactttagtctgagctcgctgagagagctcagctaaagttgtgacatagtagaccttgATGGCGATGACGACGCAAAACACGGTTCGGCGAGTGCT
GAGGAGCGACACGGCACCAGCTCGGCGACCCTTGGAGCTCGAGAACGGTGACGAGAGCACCGCAGCCCGCAACACAGCCCTAGAGCAGCAGCTGGATGCA
GCGATAGCTGACATGCGTCAAGAGATGACAGCGTTACAGGACAGCTTGAGACTGGAGGGTACGGCATCAATGACAAATGTTAGTGACAGAATCAATGCTG
AGATGCACGAAATGCAAGGGCAATTGGCGAATGTGGTCCAGACTATGACGAATATGGTGACTACTTTAAATCGGACGCAAGCAAAGGCCCAGGCTGTTCA
GCAACTGGCAGCAGAAGCTCGCGATCGAGCGGTGCAGCAAGCGCAGACGACTGTCGCCGAACAGATTCGTGGTGTGCCGAACGTCCGTTCAAGCGATCCC
ATCAATATGACAAGTCCTGCTACTACTGCTGAATGATTGTCTACGCCGCTACCACGTCTACGCAAAATGGACGTAAATCCTCCGGTCTTTGATGATCTTA
TTGATGGAATATAACTGAATAGCTTTCTGTTTCAATTTGAAAATTACTTCGAGCAGAAACGTTACGATCTCCAGCAACATGACCACCTCCTGATTCGCGA
ACTTAACCAATGTGTCCGCAAGAATGCTTTGGTGTGGTATGAACGTTACATGATGGAAGAGTGCAGCGTGAAATTATGGAGTGTGGCGCAGGAGGAGATT
AAACGTGAGTTCCGCGAACCGAACTTTGATGGCAAAGTGCGAAATCAACTTTTGACGATGCGTCAAACTGGAGCTTATCCGGGATATGTTTCTAAGCTCC
GTGATTTACAGCGTGTTGTCAGACTTGGTGAGTTGACAGCTGTGAACCTTTTCGTCAATGGTTTGACGAACACTGCAATGGGCGTGGGGCGCCACCAATG
CTCGTCAAAGTGTTCTGGTGACAGATTCAACTGCCTGTTACATTCAATCGTCGTCATCAATTCACGCAGATGCTGTCAGCCATGAATGCACATAAAATCG
ACATAGCAAACAGTGCGTTCGAGACGATGCACTACAATTTTGCACGTTTTCACCCATAGCTCGTGAGTTTTGTGAAGGCCCAATCGCTTATGATCATTGT
TATAGCAGAGTACCTGTCCTCACCGCAAGATTGCAGCAGGATCTCCCCTATATCTCCAGCGAGTGCCAAAGTGTTGAGTGAGGCGTTTAAAACCAACCAC
GACAGTAGATTCTAAAATAACATGAGGAATTCACCATTGCCGTTATCGAGCCAATGTTTCATTTTGGCATGGGTACCCTCAGCGCTAGAGGTGTCGTGGC
AGCCGAAGTTCGTAAATAGATCGGTTCAGCACCTCTCGAAGTTGTTTTTGTAGGACCATCACACTCAAATCAGGTATCCGCTCATGCTGTTGGGGAAAAA
TGTACAAGCCATATCTCTCACGCGGCAAAGAGATCGGCAAAGAAGCGAGCTGAGAAGGGCGTTGTCATCGGTGTTGACCCACAAAAGACGGCATATCATG
TCTTCATCCCGCGGACTAAGCGCATTATATCTACCACCCCTGTGAAGAACATCGATCGCCTAGATCCACGAGCTGTGGGGTGATACATGGACGCTGGTGC
GGCGGACCACGACCGCAACCAAGTCCAATTGGACGCATCGGAGAGTGAGCCAAGCTCTCAAACTAGTAATCCTTCATCGGAACGTGAGGACGTGCAACAT
GACGATGATGAAGATGGCCTCCGGCAGGAcagcccgagagagctgcacaacctgaactcccgtgctgtccagcacattttagctttgaaccgcggagcac
gagcattgtcaaacgaggattttcaactgccgtaatactttctcgacgagtttgccactccagcaaccgtgctgcttacgattgggctagaaggcggtac
agccttcataaccttgctcgaaagcgccaacaccaaagtgctgacttcggtgaaggaagcaactaacaggtcccactggcgcgaataggtacaagcgatg
cagaaggatctccgagcaatcgcaggtaatactacatggaaaatgtggacattccccacaacggaaattcgatcagcgccaaatgggcttttaagataaa
gtttgacagcaaatgtgcgtttgaaagattcaaagcccgattggtggcacgtgggttcaaccaaaagttcggagttgatttcagtgagaccttcgcactc
gtgctcaagattgcaagtttgcgactgatcgtcgctctAGTTGCGTTGTGGCATGCTACGATCCGGCAAGGTGACGTGTCGAATGCATACCCCCGAGCAT
ACTTAGACCGTCCTATCTATATGCGGGCTCCAGTCGGTCTCTTAGTGCCGAAAGGAAAGTGTCTACGCCTGCAAAACAGTTTATACGGCTTGAAGCAAGC
TATGGAACGATACCATTCAAAAGTTCTTGTTAGAAATGTGAGGAACAAACTGGACCCACGCCTATACTTCCGGCGCAGTGATGGCAAGCTGATAGTGTTA
GAACTCTACGTTGACGACATAGTGGTGGTCAGTTAGCCTGAGCGCAACTCAGACTGGGTGATGCAGAAGTTAGTAGACCAGTTTGAGACCAAGGGCATGG
ATCCCGCCAAGAAATTCCTCGGTATTAACATTGACCAGACCGATACAGACATATATTTGCACCAGACCGCCAACATAGACAACCTACTGACAAAACTGGA
CATGGAAAACTGTCGCCCAGTGGTGACGCCGATGGAATCGTCACGAAATTTGAATAGCGAAGACGCTGAGCACTTTTTCGACCCAGATGCCATGAGAGAG
ACAATTGGTTCCCTACTATAGCTGAGCACGTGAACTCGCCCAGACATTACGATGTCGGTAAATTATCTCGCGCGGTTTGTTTACGCCCCTACAACTACAC
AATGGACTGCTGCCAAATGAATCTTGCGATACCTTCGTGGATCTCGAGACCTGAAACTCGTGTACCCCCGGCCTCAAGCCTCACGAGCACACGTGACTAC
AGTGACACTGACCGAGCTGGTGAGAAGGATGCGAAGTCGACATCAAGCAGCCTGCtgacaatggccagcatgctcatctcctggtacagcaagcagcaaa
gcaccgtagcactatctacagcggaggcggagtatatcgccggggccacagcggtgtaggactgcttattggtcaagcagctcgtccgtgagcttggcct
tcacaacaacgacgacactgtcgcctagcacatcgacaaccagagAGCAATAAAGAATATGGAGAATGACGTGACCACCTCCCGCATGAAACACATCAAC
ATAAAATTTCATTTCGTCCGCGACGAAATCGCAAGGAAGGCATTCAAATCCGCTACTGTCCGACCACAGAAATGAAGGCTGGCATCCTGACTAAGCCACT
GGGTGGTATGCTGCACAGCCGTAACGTGGTCATGTTAAAGTTGATCACGTCAAACACGAGCGAGTATAGAAAGTGATCACGACTGCCACTGTCGAGGAGG
AGTGTTGGTGATCGCAGCTTGCACCACCTGCGACTGGAGCAGTGGTGCTAGCAACGACTGAAACAGCATGCGATAGCAACACCCTGTATGCTCGCAGATT
GAAACCAATGTAGAGAGAGAGCGCTCAACTCCCATGCACGAAGGACTAGTTTAGGAGCACAGATAGTGGCTCACACCTCAATTTCTCCTAATCTACTCAG
TGCGACGCTCCACTACTGGGAGGAATCCTGGCTCCTGTCCCTCTTCTACACCGACACAAGTCTCCTGTCTCCTGCGTACCATGTCCTCGCTGCCCCACTC
GCCTTTTGCTCGAGCACGTGTCCTCGACAGCTACCAGGCAGAAGGGGGCTGGATGCTTGTTGCGGCGCACAACGACATCTCGCCGACTTCGGCCCGTCGG
TTCGTGGCCAGTGGTCGCGAGGAACCTCTGCCCTGTGGCGGCTTACGGGGTGCGTGCGTGAAGTGGATGCCGGAGATTGCATCCCTCGAGAGGTACTTGA
ACGACGACTGAACCGACACGTTGCAGGCGATGATGGATATGGTGGCGTTCGACGTCGGCGTGGACATCAGCTTGTCGACCAATTCGGGCAAGCTCGTCGG
TACGCTATACACTGTGAAACAGGTGCATGTACATCTCCACCTACTCATGCATGAAAAGTCTAAAAGTACTGATCGCTCACATTGTTTGATACGCAGGTTC
GAGTTGAACCAATGACGTGTAACAACGAACAGAATAAGACAACGTGGATGAAGTTCTCGAAGCAACTACGCTCTCACATGAGTGCTGGTGACTTTATCGG
Ttactacgacgaaactaaccccaatggtcactgcaagagcactcatagtcgcgcaaagattggcgggtgatcgatccaccgtctaaaggtgtcgatcttc
aaatactttgtgcagtcTCGACCGAGGTTGGACTTGTCCACACCGACTCGAACGCGGCAGCATACGGATGGATGTCAATGCCGCATTTGTTGATGCTACT
TACGAGAAGGTGAAGGCGTCGCCTACATACCAAGAACACTTCCAGGATAAAAGGTGGTTGTCGTGCTCGACAACGCCCCAGCCCCAAGCCAAACTGAGGA
TCGTGTTGTCGACCACGTCGacctcgaactgctccgcctggcagcttattcgcctatgtgcaacccgatagagggATGCTTCAGTGTACTCAAGGCACGC
ATCAAGGCGAACCTCGCTTCGTCGCGTGAGGGGTTGGTGGCGACCAGATTGCGGAGGGGCACACGAAGACTCTGGAGCGCGCCGCCAAGCACAACGTCAG
TTGCATGGACCTCTGACTCGTGAGTAAGATGATCTTGCACTGTCAGTATGCTGTTGCGGCTGCTGAGCGTATGGAGGAGATGCAGTATGGGACTTAGGGC
TCTCCTCTCCGATTTGATCTAGGATTTCACTGCATTGCGTAATGGAATTCCAAATTTCGTTTTTTGCCAATTAGTCATATTTATTTTAAAAAATTCGTAT
TGTTCATGACCAGCAAAGGGAGCAATTTTTTAtgggtcaacacttttctttggtcaaccgtggatcagctttgaccatatttggtccatagcaaaccacg
tgattgtataacttcgatacctcttataattgtttaatttataatgtataatatatactacgcttttcaagaatatgtattagttgcacttgttttgtca
tgaaaatatcagtatgcccatagggcgtgcgcatagatagacagatgtctatcaggtgtcgtggattcaagtcccacacctgtataggagctcgatcctt
gaggtaaatgtcgtttggaaaatctccgtcagatctgagacataaccaaggatttgggtcgtccggcacgctcttcttcggaggagtaagtccctatgga
tcaggctgactcaaggatcacgagtaataacccactgtCtcaaagtgacatctcggacacaaatttttcccgtaaccaccaacatctcctccttgcgatc
gcggataggtgatgccggtccaatcggggttcggcgaaagccaggaacacaatcggacatgttctcacgggtctgtgtggtaccaaggggcctcacaaag
atcttcgtcctgcacttggtgcgccggtaggcgttgtagcgatagtagttggtgtccgttcagacgttgacatggtaccgatcgtaggaatagcctccaa
aatggacagtccccgtttccaatccggcggcggggacatcggctgaattggcacgattagcagaatgggtatcttcgagtaacgtcgacgcttcaacttg
gttaccatcactctcttcgacttccgagtttgatgattgacccagcagtataaccgtttccgtgtcactgaactcagatccttcagacagcagcgagttg
gacatcgattcatcggagacgtatcctgcgttcatggggcttgatacttgggttcggtgcggtggcggtggtggtattttgaacttggaaggtttctaaa
tgaccgcttgggcactgtacgaataacaccaatttcagatcacccacgttactgcgaaacgacttagcgagcgaccagactactggcaatcgcgatggag
caacgacgaaacagcgaacgaagtaacaattctcagtaaccctacgatagtggggtagatattaagtcacaacaacacacgaaaatccagcgattcacaa
ttttctaattatcccacaacactctaacatacagttaacggccacgcaaacacacgacatgagaaaccgcaggtcttccacatttttaaatctggtagaa
taccctcttcatggtgataaaatttgatccaattttgaccataacaaaaggttgcccccttttgaccaacttctgacccaatgaaaagagttgacccaat
tttgacctgcgcagcggttgacccataaaaaagTTTATCCGCCAAAGGTGTAATGTTTAAAAACCTGGCTTGGGTCTTGAAATGAAGCAGTATGCATGCG
GAGGAAGGGGGCGATGCTGGGAAACATACGATACTGAATGCGTCGGAGCAACGCCCCCCTTAGCAACCGCGTATAGCATTCGCTGTAAGGGTGCTGCTAT
ATTACATGTAGTTTATACATGCTCGTGATGGATATCGCATGAAGAGTGTGTCCTGTCTTCACGTCTAGCTACCTGGTTGCGCGCGCTGGTTCAGAACTTG
CTGCACCAGCACGTTCTCGATGAGCTCCTGGTCGGCTTTAATGTTGCCGGCAGTATTGCCTAGCACGAAGTTGCTGAGCGCGCGCATGTAAGCAGGGTCG
TACGTCTGGACCTCGTCGTCGAGCGATgccagtgtacacatctgcaagagcgacaggtcgtggtcctctgtggcggcagcggcacgcttgatcaacgcgt
agcaccggtagttaaaggtgagtccagccagcggcttgtgtgcgatcgaaaccggagagacactcgccacgaggatgacgatctcgcggtcagcttccac
gtaccgccgcacgatctgcttcactcgcacatcggcacgagctgtatttgcgaacagctctttggcgtagtcctcgatgatcgtgtacggagtgtcaaga
ctctGGTAGGTACAGCAGTAGAATGTCAGACCACCTAACCTCCGCAACAAAGTTGGTTCCTCTCTAGCCTCACCTTCGCAGCCTTATCATACAATTTGCC
ATTCCCACCATGCTTCTTCATCCCCTTGAAGTGGTCCCACGTCGCCTCTGCAGTATCTCGAGCATGGAAAGGCATCGCCTTGTTGGCGAACACTTCTAAG
TGCATCCCATTAACGCCCTTGTTCGATCGCAGCTGCACGCCGTGATGGCTCGACTCGGTCATGTTCAAACGGTTGGCAGCGAATACTACATCTACCTCAC
GACGTGCCTTCTCCAGCTCCCCCAAGAGCCCCCTGAAGTCATTGATATCGGCCTTGAAGTCCAACGTCCTCCCAGTGAAACACCTTCCCAACATCGGGCT
CGGTAAAGCCGAAAACTCGGCCATCTGCACACGAAAATCGACGAGAGAATGACTGAGAATCCCCCGACTCATACCTCTCCCCCGCCAAAAAAAATGATGC
GCCAAAAACCAACCTGTTGCTTGATCCGCGCCTGCACCAGCGTCTCCAGAGCCTCCGCCAGCTTCTGCTGCCGCTCTATGATGAGCCTGAGCCGGACGTT
CTCCTTCTCGGCCTTGTCCCGCTGCTCCCTCTGTCGACATGCCACCTCCTTCCACGCACTCGACACCTCGGGGTTGGCCCGACTCACCACCAGCGCGCCC
CGCTGTCTGTTCTGCTCGTCTGCGGCCTGTCGCCGCTGTCGCTGCCGCTGCGGGTGCTGCACCTGCAGCGCCTCGAGCTCCAGCTGCAGCTGCTCCACCT
TGCGCTGCAGGAACGTCATCTCGAGCCTTCGCTCCTTGCGCGCGCGGTTCGGGTCGTCGTACAGCCCCGCCTTGCGCAGCAGCCGCTTCTTGGCGTTGGC
GCGCGCTCTGCGCTGCGTCTTGTCGTCCGCGGCGTCGGGCGGCTGCGGGCCCATGACCTGCCAACTCTCGGCCGTCATCATCGCGCTGGAATCGGGGTAA
CTGTGCGCCTCGCCGTCCTGGAATGCGTACTCGTCCACGAATGAGAGCGCCGCCTCAAAGGCGCGCGCCGCGTCCTCGTCCTGCAGAAACGCCATGGCCT
GCCGCTTCTCGCCTCTGCTCGGCCGGTGTGCCTTGCTTCCCGTACTGGAGCTCGGGAGAAGGAGGTAAACGCTTGCACTAATGATTGCAGGGCGCACGCT
CTGTCCCACCACGCAGCACTGGTTATCGTCATGACTATGGAGAGGCACAATACCAAGCCTCGAAAGGCATAATGTACAGTTATAGATGACAGAGTTTGTG
GGTAGCATTGATAACGCATTCTAAGATGTGGtattgtgcttttcagggatcagatttgaaaaactaccttttacagcagcggggtaggtaaccgatacca
atttagaagcacacgagtgcaagattagaacaaCCAACCAAATCTTCATGGTAACAGGTCCGGCGAAGGTGTGGAAGCCTGAATGTCGAGAAAATAGCCG
CCAATCGGGCCCTTTCTCCTTCGTAGGACTTTTGCAGGTAGTGCGAAGAATTCAGTTTACGTCGCTTTAGCTAGGACAAAACTGTCCGCATTCATATAAT
ATAGGATATTATCCTATATTATATAAATGCGGATGGTATAATAGATGCATATATACATATTATGTAGATATATGCATTAACTCCCAGCAGAAGAGCAACC
TCGCCGATCTCCCATGCAATCGGGAGGCATTATGTCTTCCCTGACATCCTATAGCTGACCACTGCATTTGCTGGTgtttaggagttaatcagtaggagca
tcgattcttacagggatagggtgaaagcaaacccgccaaatccagccaaattggcggcttcatatctgtagatgagtttgctgctcgtgcttccaggtcc
gctggacagatctcctctctcccagctattctatgaggctaaacacctaccgtattgcccaCTTTCTTCCCCTTCGTAGCGGTCgttttggggatttgag
gactgtgacatccatccccgagagccggtttcattttcggtcgctctagccttctCCCCTAACTTCTGTCCTTACATTTTATGCGTTACAAATCCTAAGA
TTAAAGTCCTGTGATGTTTAAAAAGGATAGATCAAAGTCCCAGCAAAACAACAGAAAAGCACAATACGTGATCTCTATGTTGTGATAGTCCGGGGCCATC
AACGTCCTCGTGAAAAAAACTGAAAAGTTGACTCTCCTGTCATCTTTTTTTCTTGAAACGCTTCTGGCGTTGCAGTTGGAGTCCAACTTGGACCTGGAGC
CACGCGTACTGGCTCAGTGCCACACAACTTTCACCCTCATCACCGACTTGATGTGGTGCAGGGCAACTGCATTGTGCCGCACAATTTGTGCGAGGTACAC
TGGACGACGAGAGCTGGTATCCCTCGATCTGATCGGTCTTCCGAGTCAGTGGTGCAATTTCTGATCCATGAGCACATTCTCGATGAGCTCCTGATCGGCC
TTGATGTTGCCCGCCGCATTGCTCAGCAGAAAGTCGGTGAGCACTCGGATGTATTTGGGGTCGTAGATGGTGCCCTCCTtcgtatcaagagtcacgtgcg
caaccaactgcaaaagcgacagctcttgctcgggcgtagacgatttcgcacgcttaataacggcatagttgcggtggtgagaagtcagcccagtaaatgc
cttgcgtttaatctcgattggcgcgatcgtcgccacccaaaccacaacttcccgatcggcttcgacgtagcggcgaataatctgcttcacgcggacgtcc
gtgcttgaattgcctgcgaagagctctttagagaaatgttctatgatcgtgtacggcgtatcgagattctGCAGATCACATGTTCAACGCTAAACAACAT
TGCTCCAACAACGAAATATGAAGAAAATGGTCGTACCTGCGCAGCCTTCGCATACAGGTTTCCACGGTGCTTTTCTGAGCCCTTGAAATAGTTCCATGTG
GCCTCCGCAGTGGCATGCAGTCCGAAGGGCATTACCTTGTTGGAAAATACCTCAAGATACATGCCATTCACGCCTTCGCGCATGTGTAAGTCTTGCTGGG
TCATTTCCATCGTGTCAAGGCCATTGCCAGCAAGAACTGCGTCTACTTCGCTATATGTGGCATCGAGATACTCCAAAAGTTCTTGGAAGTCTGCAGCATC
TGCACGAAAATCTAGTGTGCGACCAGAGGGGCAAGAAATGTCGCCTGGTCGGCGAATCGACGATGAGCACTCGTCAATCTAGCACGTAAAAAGGTTAGTA
CCTTAAGAACGCGAACGTGAAAAACGTGGTCGCCACCTACCTGTTGCTGGGCGCGCTTCAGCAGTAAATTTTCTAAGCTCTTGGCCACTTTGATTTGGCC
TTCCAAAACGAGCTTCAGTCGCACATTTTCCCGCTCTGCCTTCTCTCTTCGGCCCCTCTGACGAGCGGCAAAGCCCTCCCAAATACTTGAAACTTGAACT
TCCTTGGAACTCGTAGAGGTGCGTACGTCGCCGTCGCCACCCGCTTCGCTCCCGTTTTGAGCTGTCGTTATTGCAGAAGTTATCTGGCTCGATCGCTTCT
GTAGACTCTGCAACTCCATTTCCAGTTGCCCCACCTTTTCTCGTAAGTACGCAATCTCGAGCTTCCGTTCGTTGCGAGCGCGGTTGGGGTCTGCGTAGAC
TCCAGCCTTCCGCAGCATCCTCTTCCTGGCATTGTCTGCTGCGCGGCGTCTCGCTTTCACGACCTCGACGACCGGACGCGCTGTCATTCCGGAGCTTACC
GACCTATTTGACACTGCTGAAGCATGCCGGGACCCTCGATCTGTAGCATTCGCCACAGAATTCACGGTAACCACAGCACCAGCTGAATTTGCGTCGCTTT
CGTGGTTTGGCGCGCCGTTCGACGGTATTTCCAATCCGTTCACGACCGGGGGTGGCGCTTCCGTTGGATTGTCGAGTTCTCCGACGCCTGATGCGCTGTC
GTCCTCTGCAAAGTCGTCTAGGAAGCTCAGTGCGGCCTCGAACGCGCGCATGGCGTCTTCATCTTCAGCGAGGAACGCCATCGGCTACCGCCAAAACTGC
GTACTATTTCATTTTGGGTAAAAAAAATATTTGGGTAAATTTGTGTCGAAAACCTTAGGTGGACAGGTTTTATGTCATGGCCGCAGCATCTGGTCCATGA
GGACGTTTTCGATGAGCTGCTGGTCGGACTTGATGTTGCGAGCCGCATCGTTCAGCAGGAAGTCCGTGAGTGCTCGGACGTACTTGGGGTCGTAGATGGT
GCCAGCCTGCGTGTCGAGCATGCCGTGGGAGACGagctgcagcaaggacaactcgtgctggggcgtcgacgtcctggcacgcttgatgactgcgtaatta
cggtggcgagacttgaatccaccgaagggcttctgcgccatgtcaacaggctcaatggatgcgacccacaccacgacttcgcggtcagcttccacatagc
gccgcactatttgcttgatgcgaacgtcggtgctggagttaccggcgaccagctccttggagaagtgctcgataatcgtgtacggcgtgtcgagattctG
AATTACAACGCAGAATGGCAGCATGCAACTGTCAGAAACAGCCAAAACAGACAAGTATCGTCGGCAGTTCCATCCGTACCTGTGCAGCTTTCGCGTACAG
CGTGCCTCGGTGCTTCTTTGAGCCCTTGAAATAGTTCCACGTTGCCTCTGCAGTGGCATGCAGGCCGAAAGGCATTACCTTGTTCGAAAACACCTCCAGA
TATAATCCACCCACGCCTTCGCGCATTTCCACATCTTGCTGTGTCGTCTCCATCCAAGCAAGGCCGTTGCTGGCCAGCACCGAGTCGACTTCGCGGTAAG
TGGCATTAAGGTACTCTAGAAGCTCCTGGAAGTCTGATGCATCGGCGCGGAAGTCCAATGTACGACCAGAAGGGCAAGTTACATCAACCGATCTCTGGAT
AGACGCGGAGCACTCGGCAATCTGGACGAGCAATCCAATTCAGCATAGCAAACGTTGGTCTTCCTCATAACACTAGATTCACAAACGAGGTTGTTGGAGA
AGTGGGCGTTGCCTACCTGCTGCTGAGCTCGCTTTAACAGTATGCTCTCCAAGCCTTTGGCGACTTTGATCTGGCTCGCCAAAATAAGTTTCAGTCGGAT
ATTCTCGCGCTCCGATTCTTCTCGTTGGCTCCGCTCACGAGCAGCACAGTCCTCCCATGTACTAGGATCTGACAATTGCTTCTCACTCAAATCTTCATCC
GTGGAGATTCTTCTCGCTTGAGAACCATTCAGTTGTTCGTTGCCTCTAGTACTCGTCGCCAACTCTGTCGGCATCGTCGCTGCGGGGCTTGAGCGCTCCT
GCAGAGCATGCAATTTCGTCTCCAGCTGATCCACTTTCTCGTGCAAATAGACAACCTCGAGCCTGCGCTCATTGCGTATACGGTTGGGGTTCCCGTAGAC
GCCAGCTTTGCGCAGCATTTTCTTCTTGGCGTTGGCAACTGCTCGGCGACTCGAACGCAGCACCTCAGGATCCGATTCTACTGACACAAGGCTGTCACCA
TTGGATTTTGCTTTGCTCAGCAGTCTAGACGACCGACGCAATGGTGGGTTGCTCTGCGTTGCAGCAGCAGCAATGGGGTCTGCTTCGGCATCGACTTGAA
GCTGAATATCCTCAATTAACGGCAAGTCCAGCTCGTCGCCTTCGAGTTGCTCGCCCACTGGTGCAACGTCGACTGCAACAGCCTCAATAGAGGAGCCATC
GGCACTAAAGTCGTCCACGAAGCTCAGCACCGCCGCGAACGCATCCTCATCTTCGGCCAGGAAGGCCATCGGCGGCAACTTGTCCTGTCGCCACTGAAAA
AAAGTGGCGACTCAAGTTCAAGCCCAATTTATGGTCCGACCAGATCAGATTAAAAACAATTGTGTCTGACCAAAATCCGATAACCGTGTGCGCCACACCA
CTGACGCCGTCGCGCCACGTCG