Description :
From Genome Similarity Track
Location :
Scaffold_5:742167- 749829
Transcript NameFunction/comments
Phyci_580405Hypothetical protein
Phyci_61754Hypothetical protein
Phyci_138386Hypothetical protein
Phyci_137557Hypothetical protein

Sequence
7662 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTGAGGTCGTCGCTGCACTGCGTGCGTCCGAAGTGGCGGAGGCTTGGACGGACGATGCTGACGGGGCGGTGGGCGTCGGAACGCTG
GGCTGCGTGAGCCGCCGTCGCGAGCGTGAGACCCGAGCGGGATCGCGGAGGCGAGGGCCGCTGCGGCTACCACCGCTTCTTTGTGGACGACAAGCCGCCT
CTTCTGGCGGCGAACCTCAGCGAGCTCGGCGGCGGTGCGCTTGCGCTCCGCGAGCCGGGTGCTTGCACGGGCGAGTGGGGCAGTCTCGCCAGGCCGAGCC
TCCGCGGGTGCTGGCGTAGCTGGGGCCGGTACCGGAGTCGACGGGGTCTTGGGCGCGGGCACTTCCGTCGTGCTGCTGCCAACTGCGGCTGCTGCTGCTG
GGGGTGGACTGGGCGCCGGAGTTGGGGATGGGGCTGCTCCGGGCGAGAGAGGGGCAGCAGTCGTTGGTGGCGCCGAGGGAGGGGAGGCCATGGTGGTTGC
GGGGGCTTCTAAACTTCGGTGGCTGGGGTGCAGAGCGCGAATGGGCGGCATCCTTGGCCTCCGGCTGCCGCCGGTGGTTTCGCCTTCGCGTCTGAGCACC
CAAACTTGGAAACCCCCGTTTCATTATCCTGAAACCCAGATTAGTGAGCTTGACGACCATAGAAGGTGGCGTGTCCCCACTAGCACGCTCTCGAGATGGT
GCACGCAGTATTGCCCAGCACCAAGTTGCTGGGCGCTCGCATGTAGGCGAGGTCGTACGTTTGGACCTCGTCGTCGAGCCGTACCAGCGACACATGGTCC
TCTATAGCGCCGCAGCACTTGCGCAGCGCAAAGGTAAGTCTGCCAGCGTCTTGAGTGCGGTCGAAACGGAGATTTTTATGGATCACGCTCATGCTAGGGC
AAAATAAATTTGATGTTCTCGCCACCCAGTTGCTCTCTTGGAAGCCGAGGCCACCGTGGCTTCCTCAAGTTAAGTCCAATTGCTGCCAATGAAGCTGGCT
AGTGACGTGTGTCCTGATCTACATCTGCCTGCTTACCAGCGGAGCTCTCAGCAAtagagatatttcgcagcctgcagctcccatcacaacaacagcaaag
agcgtgtcacgggttcaaagcaagataacggcaagcagcgaggtgatagtgtgaatcaccatggacaccaactacaaagtatcgaacccatggcgtatgc
ctgggcaggtatcagatgggagcaagattaggagtgtagccaatctatagcgagcctagtagtttgatgaggttttagtatgaggaaagtaaggatgcga
gagatgaagttgaagtgctggcgaagcacgacagcttcacctctctcattccggaatcaaccacaatggatttaactcgggttcctatttgctgctttga
tcaagcagcttcatgtggctctccacgacctcgacaaactgagcgagaggccccacgactaaataactacaaccaacgacctcacttactctgaaagtgc
taccaaatcgcactttagtctgagctcgctgagagagctcagctaaagttgtgacatagtagaccttgATGGCGATGACGACGCAAAACACGGTTCGGCG
AGTGCTGAGGAGCGACACGGCACCAGCTCGGCGACCCTTGGAGCTCGAGAACGGTGACGAGAGCACCGCAGCCCGCAACACAGCCCTAGAGCAGCAGCTG
GATGCAGCGATAGCTGACATGCGTCAAGAGATGACAGCGTTACAGGACAGCTTGAGACTGGAGGGTACGGCATCAATGACAAATGTTAGTGACAGAATCA
ATGCTGAGATGCACGAAATGCAAGGGCAATTGGCGAATGTGGTCCAGACTATGACGAATATGGTGACTACTTTAAATCGGACGCAAGCAAAGGCCCAGGC
TGTTCAGCAACTGGCAGCAGAAGCTCGCGATCGAGCGGTGCAGCAAGCGCAGACGACTGTCGCCGAACAGATTCGTGGTGTGCCGAACGTCCGTTCAAGC
GATCCCATCAATATGACAAGTCCTGCTACTACTGCTGAATGATTGTCTACGCCGCTACCACGTCTACGCAAAATGGACGTAAATCCTCCGGTCTTTGATG
ATCTTATTGATGGAATATAACTGAATAGCTTTCTGTTTCAATTTGAAAATTACTTCGAGCAGAAACGTTACGATCTCCAGCAACATGACCACCTCCTGAT
TCGCGAACTTAACCAATGTGTCCGCAAGAATGCTTTGGTGTGGTATGAACGTTACATGATGGAAGAGTGCAGCGTGAAATTATGGAGTGTGGCGCAGGAG
GAGATTAAACGTGAGTTCCGCGAACCGAACTTTGATGGCAAAGTGCGAAATCAACTTTTGACGATGCGTCAAACTGGAGCTTATCCGGGATATGTTTCTA
AGCTCCGTGATTTACAGCGTGTTGTCAGACTTGGTGAGTTGACAGCTGTGAACCTTTTCGTCAATGGTTTGACGAACACTGCAATGGGCGTGGGGCGCCA
CCAATGCTCGTCAAAGTGTTCTGGTGACAGATTCAACTGCCTGTTACATTCAATCGTCGTCATCAATTCACGCAGATGCTGTCAGCCATGAATGCACATA
AAATCGACATAGCAAACAGTGCGTTCGAGACGATGCACTACAATTTTGCACGTTTTCACCCATAGCTCGTGAGTTTTGTGAAGGCCCAATCGCTTATGAT
CATTGTTATAGCAGAGTACCTGTCCTCACCGCAAGATTGCAGCAGGATCTCCCCTATATCTCCAGCGAGTGCCAAAGTGTTGAGTGAGGCGTTTAAAACC
AACCACGACAGTAGATTCTAAAATAACATGAGGAATTCACCATTGCCGTTATCGAGCCAATGTTTCATTTTGGCATGGGTACCCTCAGCGCTAGAGGTGT
CGTGGCAGCCGAAGTTCGTAAATAGATCGGTTCAGCACCTCTCGAAGTTGTTTTTGTAGGACCATCACACTCAAATCAGGTATCCGCTCATGCTGTTGGG
GAAAAATGTACAAGCCATATCTCTCACGCGGCAAAGAGATCGGCAAAGAAGCGAGCTGAGAAGGGCGTTGTCATCGGTGTTGACCCACAAAAGACGGCAT
ATCATGTCTTCATCCCGCGGACTAAGCGCATTATATCTACCACCCCTGTGAAGAACATCGATCGCCTAGATCCACGAGCTGTGGGGTGATACATGGACGC
TGGTGCGGCGGACCACGACCGCAACCAAGTCCAATTGGACGCATCGGAGAGTGAGCCAAGCTCTCAAACTAGTAATCCTTCATCGGAACGTGAGGACGTG
CAACATGACGATGATGAAGATGGCCTCCGGCAGGAcagcccgagagagctgcacaacctgaactcccgtgctgtccagcacattttagctttgaaccgcg
gagcacgagcattgtcaaacgaggattttcaactgccgtaatactttctcgacgagtttgccactccagcaaccgtgctgcttacgattgggctagaagg
cggtacagccttcataaccttgctcgaaagcgccaacaccaaagtgctgacttcggtgaaggaagcaactaacaggtcccactggcgcgaataggtacaa
gcgatgcagaaggatctccgagcaatcgcaggtaatactacatggaaaatgtggacattccccacaacggaaattcgatcagcgccaaatgggcttttaa
gataaagtttgacagcaaatgtgcgtttgaaagattcaaagcccgattggtggcacgtgggttcaaccaaaagttcggagttgatttcagtgagaccttc
gcactcgtgctcaagattgcaagtttgcgactgatcgtcgctctAGTTGCGTTGTGGCATGCTACGATCCGGCAAGGTGACGTGTCGAATGCATACCCCC
GAGCATACTTAGACCGTCCTATCTATATGCGGGCTCCAGTCGGTCTCTTAGTGCCGAAAGGAAAGTGTCTACGCCTGCAAAACAGTTTATACGGCTTGAA
GCAAGCTATGGAACGATACCATTCAAAAGTTCTTGTTAGAAATGTGAGGAACAAACTGGACCCACGCCTATACTTCCGGCGCAGTGATGGCAAGCTGATA
GTGTTAGAACTCTACGTTGACGACATAGTGGTGGTCAGTTAGCCTGAGCGCAACTCAGACTGGGTGATGCAGAAGTTAGTAGACCAGTTTGAGACCAAGG
GCATGGATCCCGCCAAGAAATTCCTCGGTATTAACATTGACCAGACCGATACAGACATATATTTGCACCAGACCGCCAACATAGACAACCTACTGACAAA
ACTGGACATGGAAAACTGTCGCCCAGTGGTGACGCCGATGGAATCGTCACGAAATTTGAATAGCGAAGACGCTGAGCACTTTTTCGACCCAGATGCCATG
AGAGAGACAATTGGTTCCCTACTATAGCTGAGCACGTGAACTCGCCCAGACATTACGATGTCGGTAAATTATCTCGCGCGGTTTGTTTACGCCCCTACAA
CTACACAATGGACTGCTGCCAAATGAATCTTGCGATACCTTCGTGGATCTCGAGACCTGAAACTCGTGTACCCCCGGCCTCAAGCCTCACGAGCACACGT
GACTACAGTGACACTGACCGAGCTGGTGAGAAGGATGCGAAGTCGACATCAAGCAGCCTGCtgacaatggccagcatgctcatctcctggtacagcaagc
agcaaagcaccgtagcactatctacagcggaggcggagtatatcgccggggccacagcggtgtaggactgcttattggtcaagcagctcgtccgtgagct
tggccttcacaacaacgacgacactgtcgcctagcacatcgacaaccagagAGCAATAAAGAATATGGAGAATGACGTGACCACCTCCCGCATGAAACAC
ATCAACATAAAATTTCATTTCGTCCGCGACGAAATCGCAAGGAAGGCATTCAAATCCGCTACTGTCCGACCACAGAAATGAAGGCTGGCATCCTGACTAA
GCCACTGGGTGGTATGCTGCACAGCCGTAACGTGGTCATGTTAAAGTTGATCACGTCAAACACGAGCGAGTATAGAAAGTGATCACGACTGCCACTGTCG
AGGAGGAGTGTTGGTGATCGCAGCTTGCACCACCTGCGACTGGAGCAGTGGTGCTAGCAACGACTGAAACAGCATGCGATAGCAACACCCTGTATGCTCG
CAGATTGAAACCAATGTAGAGAGAGAGCGCTCAACTCCCATGCACGAAGGACTAGTTTAGGAGCACAGATAGTGGCTCACACCTCAATTTCTCCTAATCT
ACTCAGTGCGACGCTCCACTACTGGGAGGAATCCTGGCTCCTGTCCCTCTTCTACACCGACACAAGTCTCCTGTCTCCTGCGTACCATGTCCTCGCTGCC
CCACTCGCCTTTTGCTCGAGCACGTGTCCTCGACAGCTACCAGGCAGAAGGGGGCTGGATGCTTGTTGCGGCGCACAACGACATCTCGCCGACTTCGGCC
CGTCGGTTCGTGGCCAGTGGTCGCGAGGAACCTCTGCCCTGTGGCGGCTTACGGGGTGCGTGCGTGAAGTGGATGCCGGAGATTGCATCCCTCGAGAGGT
ACTTGAACGACGACTGAACCGACACGTTGCAGGCGATGATGGATATGGTGGCGTTCGACGTCGGCGTGGACATCAGCTTGTCGACCAATTCGGGCAAGCT
CGTCGGTACGCTATACACTGTGAAACAGGTGCATGTACATCTCCACCTACTCATGCATGAAAAGTCTAAAAGTACTGATCGCTCACATTGTTTGATACGC
AGGTTCGAGTTGAACCAATGACGTGTAACAACGAACAGAATAAGACAACGTGGATGAAGTTCTCGAAGCAACTACGCTCTCACATGAGTGCTGGTGACTT
TATCGGTtactacgacgaaactaaccccaatggtcactgcaagagcactcatagtcgcgcaaagattggcgggtgatcgatccaccgtctaaaggtgtcg
atcttcaaatactttgtgcagtcTCGACCGAGGTTGGACTTGTCCACACCGACTCGAACGCGGCAGCATACGGATGGATGTCAATGCCGCATTTGTTGAT
GCTACTTACGAGAAGGTGAAGGCGTCGCCTACATACCAAGAACACTTCCAGGATAAAAGGTGGTTGTCGTGCTCGACAACGCCCCAGCCCCAAGCCAAAC
TGAGGATCGTGTTGTCGACCACGTCGacctcgaactgctccgcctggcagcttattcgcctatgtgcaacccgatagagggATGCTTCAGTGTACTCAAG
GCACGCATCAAGGCGAACCTCGCTTCGTCGCGTGAGGGGTTGGTGGCGACCAGATTGCGGAGGGGCACACGAAGACTCTGGAGCGCGCCGCCAAGCACAA
CGTCAGTTGCATGGACCTCTGACTCGTGAGTAAGATGATCTTGCACTGTCAGTATGCTGTTGCGGCTGCTGAGCGTATGGAGGAGATGCAGTATGGGACT
TAGGGCTCTCCTCTCCGATTTGATCTAGGATTTCACTGCATTGCGTAATGGAATTCCAAATTTCGTTTTTTGCCAATTAGTCATATTTATTTTAAAAAAT
TCGTATTGTTCATGACCAGCAAAGGGAGCAATTTTTTAtgggtcaacacttttctttggtcaaccgtggatcagctttgaccatatttggtccatagcaa
accacgtgattgtataacttcgatacctcttataattgtttaatttataatgtataatatatactacgcttttcaagaatatgtattagttgcacttgtt
ttgtcatgaaaatatcagtatgcccatagggcgtgcgcatagatagacagatgtctatcaggtgtcgtggattcaagtcccacacctgtataggagctcg
atccttgaggtaaatgtcgtttggaaaatctccgtcagatctgagacataaccaaggatttgggtcgtccggcacgctcttcttcggaggagtaagtccc
tatggatcaggctgactcaaggatcacgagtaataacccactgtCtcaaagtgacatctcggacacaaatttttcccgtaaccaccaacatctcctcctt
gcgatcgcggataggtgatgccggtccaatcggggttcggcgaaagccaggaacacaatcggacatgttctcacgggtctgtgtggtaccaaggggcctc
acaaagatcttcgtcctgcacttggtgcgccggtaggcgttgtagcgatagtagttggtgtc