Description :
From Genome Similarity Track
Location :
contig_31:74211- 76661
Transcript NameFunction/comments
g7455.t1hypothetical protein

Sequence
2450 bases(100 bases per row)
TCAGTGGAGTCCAGCCAGCATCATTTGCCAAGTCGACAGAAGCTCCACTTTCCAGCAGAAATCTCACCACAGCGACGTGTCCGTATTGAGAGACATACTT
CAGTGGGGAGTTGCCGTCGTCGTCTTCTGTATCAACTGGAACACCCTGTTTTAAAAGATCCTGAACAATCTCGAGCTCTCCCTCCTCACACGCTGTGAAC
AGCTCTCTGCTCTTGTCCGAGCTCTCAACTTCGAGGTGCATCGTCAATTCTTCGTCTTGTATTTCCAGTGCAGCACAATTCTTCACATCTTGGTCTTGAA
CCGCACCTTCCGCATCAGTTCTGGTTCGTGCCATGACTTGTGGCATCTCCAAGCACACTTTCACCAAATCTCTCCCCGCTCGACGTCTCCCGCGCAAATT
GAAGAATGGCAGCATAGTGGCCAGAGCGCGTGCATGAGCCAGCATATTGTACCCACTGTTGGCAGGTGCGTGTTTAATTAACGAGACTAGCACATATTCG
TATTTGGACATCTTTTCCGAGAGTACTTTCACGACTTCCTTGTGTCTGTTCTACACGGCAACCACGAGAGCAGTTAGCCCAGCACTATTAACTGGATGCA
TCGAGGCACCCTTTTCAGCCAGGACCTTCGCCAACGCAGCATTACCACTTTTGGCTGCTTCGATGAGAGGGGTATCGCCGACTTTGTCTGCGAGATCGAA
AGACGCGCCTTACGAAGTAAGCAACTTGACAACTGCGAAGCGATCGGCATGGTGTTCAATCCAAACCACGTGTTTCATATCCACGAGTCGCTACCAGTAC
TGCACGTGACGGAATTGTTGCCTTGCTGGGTTATGCAAGTCCAAGTTCTGTATATTTGTGTTCTACATACTGAAACTACACTCAAAGTCCTGGCATCACA
ACTTGCTGCTTACGTTGCGTTTTTCCTGTCAACTTTGGTTGCCCCCACCATCATCCCAGACCTTTCGAGCAAGTTCCTCACGCCGATATCTTCCAGAATC
TTGACAACGGCACCAATTCCGATGCGCTGCGTAGGATCACGACGACACATTCGCTCAATGAGATCCCATTCCTCAGTTTGGAATTTCTCTGAACGTGTGG
GTAGTTCTCCCTTTTCCGCTTTGTGAGTCACAGTTTTGTTATCAAGCATCCCCCACGGATGCTCCCCGGTCACAGCCTCGATGATGCACATTCCGAACGC
ATAAATGTCCGAGGCGTAGGTAGGAGGTTTACCTTTCAAGCACTCGGGTGCCATCCATTGCACTGCAGCTGTCATCAGTGTCTTATCCTCGGAAGTGTAG
GCCAGAATGCTCAGCCCAAAATCGGCAATCTTTGTCGCTCCCCCTTCACAAACGAGAATATTATTCCCTTTCAAGTCTCCATGTACGATGTTGTGCTCGT
GAAGGTGCTGAAGTCCTAGCGCTGCTTGCAGTAAACGAAACCAGGTCTCGTGGCGTCTGCTCTTCAAATACGTGGGGAGGATACCCCGCGTTGCACGCTC
GCAGACGAAAAAAGGCTGGCCCTCGTAGCATGCAGCGTACAGCTTGATCAAGTTGGAATGATTCAGCGTGAACCACAGATCTGCTTCTTGTCGGAACTTT
GCCCGTTTCTCCGGAGTGATGACGGGGGAAATATCCAGTTTAACCACAACATCCGTTCCAAACCATTTGCCGTGGTACACAGTTCCAAATCCGCCATCGC
TAATATGCTTTCCGAGCTCAATCTGGTAGCCGGGTACAAACCATTTGGGAAGTGCTTCTCCAACTTTCGCACCCTGCAGTGTTGGTATCTTTTTGGCAGC
CAAGACAACCTTTATCTTTTCCACATCTTCAGGTGAATAAGCTCCAGAACGGCTGTGGGCCTCGAAGCGCATAGTAGTCAAAGCTTGAGTCAACTGGTTG
CTGGGAATCTCATCGAGAAACTGTTCGGGGTTATTCAAGCACGACTGAAACAGTGTAAATTGCTCCTTCCGAGCTTGTTGCCACGTAGGCTGCCACTGGT
GCCAGGCGTTTCTTTTATTGAGGAGAGGTGAACTTCGTACGAGATGATCGATTCTGTAGTGAAAACGGGAGTTCATGTTGCCTGTCGTCTTTGAAATCTT
TAAATTGGAGCGAGAACAGTCGAGACAGTCTTTATCAGCCGTTTTGCGAAAAGCCCGTGCCAGTCCACAAAACTCATCAAGTAACCCGGACGGTACCGGC
TCGGATAAATTCAAGAGTTGCGTGTACACGTCATGGAGACGATTGCACACGCGTTCATTCTTCTCCGCGTCTAAACCGGCTGCTTGTCTGCATTTGTTCT
TGATCCCACGCATTACTTCGGCTAGAGTTTCACCGCCAACAGTACAATCTTTCTCGAAGTACTTGCTTACATCCTCAACAGCTGAAGTTTGTCTCTCTCC
GTTTTCATCTGGTATCAGTGATATGAAACCCGCGTCAGCCAGCTTAGTTC