Description :
From Genome Similarity Track
Location :
Scaffold_69:74200- 76682
Sequence
2482 bases(100 bases per row)
GTGGTGTAGCCGTTCTAGCTGTGCTGAAATCAATGCCGTCTAGTATTGAATTTGATCCAATGCTTGACGGCATTATTATTCATTTTTTTTACTGGTACAC
TGCTAAGGCATCGACTACTCTAGTTTTCATTAATGGCCTACATGAGTTGCATTAGCTGGACTGAAAAACAGCGTCTAATAACGTCTCGTACCGACGCGAG
ATATCCGCAGCGTAGACTTATTATTGCAACTCGGGCATACGTCAAAGACCGAAATTGCCACAACTTCTTCTTCAGATCTTTGTGGTGTATTCAGGCAACT
GAAGACACACGGGGGCACTGGCGGAGGCCCAGGAAGTTATCGCCAAGTGTATTTGCTGGTAAATTGCAAACTGAGGATCCTTATCTATCCTTACTCATTG
CGAAGGCTTGTCTTGCCTTCGGCGACCACGTTGTTTGATCAGTGATGGCAATAGAAAATTCTTTCCATAAAAGGTTCAAACATTTTTTGATTTCAAATTC
TTTCAACGAACGTTTGAACATTAAAACGAAGCAAAACACTTTCTAATCGAATAGAAATGCGTTGGAGCAACTACAGCAGCAACGCTAATAGTAGCCTCGT
TCAGGTTGAAGCTTAGATGCGTTTGCGAATCACTTTCCCACTCTTGCTTTAAGAATGGACAATTGGACCTGAAGGAAGCAAGCGCAGATGGAGGATGCGC
AGGTGATGCTCCGGACGCCGGGGTCCCTGTCGACGCTGTCTTTGTTGATCCGCAAGTGCCCAACGAATTACTTGGCCGGAGGTTTGCCGCTTGCTTCTGT
CCTCCTGCACGACGTACTTTGGTTTACTGAATAGAGGCCCTTTTTGTCATTTTGGGGGGTTTACTTTCATCAAGTAGCACGATTTTCGTACTTAGTAATA
CGGCATTTCGAACGTTTTTGAAAAAAGTTTGAAATCCAATTGAAGTTCGTTTAAACGTTCGTATTGCCATCCCTGGTTTGATTGGGTGTCGTTGATGTCA
TCGCGTTTGTCGTTATGCATGCTGGATTGTCACCAAGTTCTGCGTTATGCAGGTGCTGGTCATCCTGTGCTGCGTTATTTCCATGGGTTCATCATGCAGT
GATCGGGCTGGCCCTTACTGGTAAGAGATCAGCCTATTTGCCGTTGTTGAAACCTTAACAAGGCTTGCTCATACAAGTATATGCCCTGCACTACCATATT
AGTCAGACACTCTTCCTGATGCCACAGAAGCCGTTTTAGCAGCATTCTACTCTTTTCTTTCACAATACTCTACATACTCTTTCACCGCCATTGTCCCAAC
CAGGATTATCGAAATTGCTCTTCAGACTCCGCTTCATAAAATGAATGAGAGCTGCAGCATACGAAAAGAAAAAATAAACCACAATCTTTTCGACTGAGAA
ACCTGGAAAGAAAACTCGTTTATTTGGTGTGCCACGAATGTTGACCCAGGCTACGTTACGCATTCGATCTACGCAGTACCCTGGCATTAATCCGTTGTGG
GCTGTCCATACCTCTATGAGGCATTCCCAGTATACATGTAACATCAACGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN