Description :
From Genome Similarity Track
Location :
Scaffold_184:7418- 10947
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_184-fgenesh-gene-0.2Dynein heavy chain

Sequence
3529 bases(100 bases per row)
AAGTTGCCAAAGTCAGCGAACCCTGGCGAAGTCGCCGCTGGCGCCGATGATTCGTTTCCAAAGCTCGAAAAGTCGCCAAACTGCGCAAATCCACCAGTCG
AAGCCGCCGCTGGTGCGACGTTGCTGTCGAATGCGTCAAATACTGGAACTGGGGCTGCGTTTTTCTTGCTAGAGGACGAAAAAAAATCCTCTCCATCCGA
CGATTTTGTTCTTGAGCTCTTCGAATCGGTTTTCTTGCTCTCTCGCGGCGACTCGTAGACCCATCTGTCGTCGAAAGTCAAAAGGTCAGTCTCACATCCA
TCAACACCACGATAATCAACGCAGTACGCACTTTCGATCGATGTAGGTCAGTCGGATGAAGTTGCGCGTACGATCACCATCGTTGCCTCCGTTGGGGCGG
AAGCTCGGGTCGTGCTTGGAGCGCCAGTACTTTTGCGCAGCCTGCGTGATAGCAAGCGGTGAAGTCACGGTCAGTAAATAATATATATGTTGATCCGCGT
TGACAACGTGATGTGCATCGCACGAACCTCATTGCCACCCAGCTGGACCAGCGTCTTGATCTCGGATTCGGTGAACTTGGACATGGAGATCGACTTGACG
CGGTGCGCAAACTCGCGGCTGTAGCAAGGCAAGTACGACCACACAAAATGAGCACATTGTCTGTTAGCACAGGCATATAGACAACATACAGCAAAGAGAT
AGATGGAGAACGTACTGGATGCCACTGCAGGACGTGCACACGAACGTGTTGAAGTCCAAACAGACGTACTGCGGCATCTGTTTTTCATTCGCATCGTTGT
CAAGACAGAAGCCACACACACACGCATTATTACGTTAGACATTTCGCAATCATAACAGCGCGCCTTCATCCAGCAAGTTGTAGTGACGCGGCGTACCATT
TCATTGCAGTCAAAGCATCGGCGGTTCGACGGACTCGAGCGCTGGAAGTCGCGCAGCTCCTTAATGCGCTTCTCCTCCTGTCGCTTCTCTTCAGCTGGCG
AGATCCCCATCCTTGGCGTTCCCGTTGTTGCTGAACTTGCAGTCTTTGGCTCGAGGCTCTGGTTCAGAAGAAGATCTCCAAGTGGTCTTCAGAAAACGCG
CAGTCTCTCTTCTCTCACGCTTAGACGCAGAAGACAGAGGCGAGTGGGGAAAGCGGATGTACGCAGGCTCTTCTCACTCACTCACGCTCTAATGCACAGA
CGCAGGCAGACGCAGAGGAGACAGAGATACAGAGAGAGCTCGTGCTGGAAACCGTCGCCACGTTTTGTTTTGCTTTTCACACAAAAAGAGCAGTGAAAGA
GGGGGGTGGTGACTTCTCTTGGATTCAGTATGCCCCTGGGGTTTCGTTGTTGTTCATCCGCGTTACATTCAAACAACATGTTTACATCAGATTCGAGAAC
CTGTCACATTCAGACAACATGTTGTATCAGATTCGAGAGGGGCAATTTACAAGCTCAAAAATCACAATTGCAAATCAAAAGCGCGGGAAATTAGTAGGCC
AACCGCGCGAGGATTGGACGCGGCGTGGAGATCGAGCCGTCCGCACACAGTCAACGTAGCGCTCGCGCACTTGCGTTGTGCGGGTCTGCGCTGCTGCCTG
CGATGAGGGCGTATCACGACTGAAGCACGAGCAAGGTGCGAGACCGGAGCTGCTCCACTCAACGATTCATCCGGCTAAGTACGATTTGTGGTCATCCACC
TTCGTGCAACATCATCAACAATTCCCGAAAGGTCGTGCAAGTTCAACCAACAAGTGAATGCGGAACACGAAGCGACGCACGACACCGTGCCTCGCCAGTA
TCGGATCTTCACCTCTCTGGGTCCATTGACGCCAGTAGCAGGTCGAGGGCGCAGCTGCCATGAGCTCGTCGTTCGACGATGTCGAGTTCATCGTGCAATG
GATCCGCGACCGCATCACGCTCCCCGGGTACCAGCCCAAGGCGTGGACGTCCATGGACCTCGCGACTGTAAAGGAGTTCGTCGAGAGCACGAGCACGCCC
GCGCTCTTCATGTGTCTACTCAACGGCGCGCTCACGGTCTCGACCGCGGCCCCGCGAGGCGCGAGCACCGTCATGTACTTTGTCAAGAACGGCCAGGTCG
TGCTCACGCCGGCCAACGTGAAGGAGTCGCTCCAGTTCGGCACGGTTGAGAAAGACGCGATCGCGTCGTTGCTGCACCTGATGAACGGATACTACCTCCA
GCGGCTCCAGGCGAACAAGTCGTGGCCCGAGAGCATCCAGAAGGAGTTCACGGGCCAGTTCTACCGCTTCATGTCGAGCCTCACAGAGACTGTGAGTCGC
GGCTGCGGCAAGACCGTGCTGTACCTTCCGCCCGTGAGCCCCGACAAGTTCAATCACAAGGACAAGGACCTCGTGCAGCAACTCGAGTCGACTGTGATCC
ACTGGACGCGCCAGATCAAGGAAGTGATCAATAACCAAGACAATGCGCACGACGCCGAGGGCGCGGGACCGTTGGAGGAGATCAAATTCTGGGAGCACCG
CACGCAGGACCTCTCGGGCATCACGGACCAGCTGAACCGCCAGGGCGTGAAGGAGATCGTCGAGATCCTGCGTGCCGCTAAGTCGTCGTACCTGCAGCCG
TTCGAGACGCTGTCGCAGATCATCAAGCAGGGCTCGCTCGAGGCGAACGACAACCTGATGTTCCTCAAGAAGCTCAGCCCCGTCTGTGAGGAGATTGCGC
GCGCGCAGCCCGATGAGATCCCGCTACTGCTACCCAAGCTGCTCAACTTTATTCGGCTCATCTGGATGTACTCGCACCACTACAACACGGAAGACCGCAT
CACGAGTCTGCTGCGGAAGGTCAGCAACGAAATCATCGTGGTGTGCTGCAAGAAGATCTCGCTGCCCGACATCTTCAACGGGAACGTCGAGGCATCTATT
TTGCACTTGGAGCAGAGCATTCAATGTGGTGTCTCGTGGAAGCAGATCTACCACAAGGCTTCGAGTGCGGTGAACACCATGGCCACATCTCCAGATCGCC
GCTGGACGTTTGATGAGACAGGCATCTTCGCACAGATTGACGCGTTTGTGCAGCGGTGCCGGGAGCTGCTTGAAGTCTGCGAGGGACAGATTCAGTTTGC
GCGCAAGGGCAAAGACGGAAAGCGCGAGGCGTTGCCGACGTTCGGAGGCAATCGCGGTCTCGAGATTGTCAAAAGTCTGCGTGGCATTGAGGCGCAGTTT
GAAGGCCACGTCGAGCGCCTGCGCAAGCTTGACTACGACATCCTCGACGTGAAGATTACGAGCTGGCACAGCGACTTCAACGCGTTTAAGAATGGTATGA
AGGACCTCGAGGCCATGACCCAGAACGTGATCAATGGTGCGTTCGAGAGCGTGTCGATGATATCTGCGGGCGTGGATCTTATCTTGGCGTTCCGCAAGAT
TGCGCAACGCGAAGCGATCAAGCGCTGCGTGGAGAAGCGCACGATCGATATCTTCGGCATGTTCAAGTCCATTACCGCGACGATCCGCAACCTCTTTGAG
AAGAACAAGCAGGCGCCACCGCTCGCCCC