Description :
From Genome Similarity Track
Location :
Scaffold_65:74175- 93831
Transcript NameFunction/comments
Phyca_LT1534126784GI10429
Phyca_LT15345747262-oxoglutarate dehydrogenase E1 component, putative
Phyca_LT153411250protein serine/threonine kinase
Phyca_LT1534510685memo-like protein
Phyca_LT1534126970zinc finger MYND domain-containing protein 10
Phyca_LT1534554791myosin-like protein
Phyca_LT1534510686myosin-like protein
Phyca_LT1534554794nucleoredoxin putative
Phyca_LT153411255AlNc14C4G614
Phyca_LT1534574738formate-tetrahydrofolate ligase
Phyca_LT1534554801putative mediator complex subunit 31
Phyca_LT1534536853unnamed protein product
Phyca_LT1534510690Hypothetical protein

Sequence
19656 bases(100 bases per row)
ctgagcaatactccgtccctccccgacagttctggtggacattattacgtgtactggcaagaaccgatcaatgggagacactgttagctttggctggagc
tattcgacctcctatcgggtatattccaatcgtagaggtgatgctggacgaggacaaacacgatctagtagagcacctgctgcctgtcatacaagatgaa
gaagaacgcgaacaagtgatatcattgctagcagaagagcaagatgaagaagaccaagaacctcatcaacttgacacactgtaaaaccaaatacatactt
caactggcaaaaaccgtcatatgaatggcctttctttgcatgttttgtcttcaacgtccaagtttatcttgctttttgtatgccttcgtccacgtccaat
ccgacgtttggatttcggtatccccatcacaaaagtctataggaacctcattgctacattccgaattcctccagaccccacacacccgacgcctatttgt
ctccatgctgcgtctccccggtcttctgacgcgtcaccgtgtcgtcccaacgaatgcgcgtgtcgtgttgcccaaggcgcttttctcttcagcctcatcg
ctcgagtctctggccgctaagtccatggccacggccttccgccaatccggacatctgcaggccgacctggacccactcaagctccaacaacgctcagctg
tccccggcctagcagttgacaacttcaagccgctgttgactcgtcctcttgcagctacggacctggaaggagtggtgtcggttgctgccgtgaatggtca
acagctctacgatgaactgcaccgcgtctactgcggcaaaaccggctttgaattcgagcatttgaactcggcggaggagaaaaagtggctggccaatgct
gctgagactctggcagctaacgaggtctctccctcggacttacgcaatgcgtactctagtatgctacgtgccgatgtttttgaatcttttatggcgaaaa
agttcgcgtcgtttaagagatattcaggcgagggtgcggagtccatgctaccagcagtcgagactgtgctacagacctgcacaacgtcgggtgtgtctga
tgtagtgatcggtatgccacaccgtggacggttggctctgctggttggttcgctggaataccctgcacacaagatctttcacaaagtgcgcggctactcg
gagttccctgacaacttccgtggcatcgacgacgtatcatctcatattgccacgacactggacaagaaatacgcagacaagaaggtgcatgtgtcacttg
tgcacaacccgtcgcacctggagatcatcaacgctgtggcagccggcaaagtacgtgccaagaatgatggtgatgctaatacgaacgctatggcgctgtt
gctgcacggtgacgcagcctttgctggacaaggttgcgttccggaggctttggcactttcgcagcttcctgacttccaaacgggtggatcggtgcacatt
gtggtgaacaaccaagtaggctacacgaccacgtacccggacggtcgtgcgacgcgctatgcttcggatatcgcgaagagtatcgaggcgccgatattac
acgtcaacggtgagagtatcgtcgacgtcattcgtgcgtgtcgtcttgcagtcgcgtatcgcaaccggttccacaaggacattgtcattgatctgatcac
gttccgccgtcatggacacaacgaggtggatgagccgcgcttcacgcagccaaagatgtacgagcgcgtggatcaagcggagcgattccccattaagttt
gctcacgagctagaagctgttggtctcgtctcgcgcactaacttcgaaaagactgtcgagcgcctgaacgaccacctcgagagcgaactcaagaaggtca
cgggagaacctgcgtacaagccaacggagatcgacgcgttcaaggggaaatggtcaacgatggcgcagcctaagcctgaagacctgtacgtgaacgagac
tactggcgtagatatcgacaacctcgtccaggttggtcttgcttccgttgagctgcctgagcgtattcaaccacacggccgtctgcaacgcacgcacatc
aaagcacgacagaaaatgctgcaggtcaaggacggggaaaacccagcggatgcgcgtgtcgactgggctacagctgaagcaatggcgtttggcactttga
tgcaagatggtcactcggtgcgtcttgcggggcaggactgtcgtcgtggcacgttcagtcaaaggcatgcttcattcactgatcaggagacagaggagag
gtatttcccgctgcagcaccatttgccgaacaagtccgacacgactggaaaactcagtgtggtgaacagcaacctgtctgaactggcggtcatgggttac
gagtacggctactcggtggagagcccagataatctggtgatttgggaggctcagtttggtgacttcttcaatggcgcgcagattgtgatcgaccagttct
tgtcgagcgctgagtccaagtggatgcgtcagtccggtctgatgttgttgctgcctcatggcaatgacggagccggtcctgaccactcaagtggccgcgt
tgagcgcttcttgcagcttgtggacactcctgggctaacccctcgatcctccatgaaggaatcggataccgaggctgtgtggaagcaatatcaacacgac
accaacatgattgtggtgaacatcaccacaccggccaacttcttccacttacttcgtcgtcagcagcaccgtacgttccgcaagcccgtgatcattatgg
gaccgaagatgttgctacgtctgtccgacgcgacgtcaccactatccgagatggggccaggcactagtttccagcccgtgctttcggacccgagtatcac
cgacgcctcgcaggtcaagaaggtttacttctgctcgggtaagttttactacgaactcgcgaaggagcgccttgctcgctgcaagaacccagagagcatt
gcgctagtccgtctggaagagttggcaccgttcccgttcgagcaggtcgctaaagagttgtccaaattcgagaacgccaaaaagtttgtctgggtgcagg
aggagccgctgaaccagggtgcctggacgtacgcccaagcacacattgagaagttgctgggtaagaagcagcaccttgagtacattggccgtgagacgct
tgctgctcctgccgtgggtttgtcgaaacgctcacatgagcagctcgaggtggtgctgactgaagcatttggtccgcaaaagtaaatgcacgaaaagctt
cagtgctagtagacgttcaattgttcaccatgtaagaagagaaacaaacacaactgatatgaatgtccagtgggcaaagatactacgtccatttgaaaag
tatgttcactgaatgttgccatcctcttgcggaatgatctgtgttcttgctttcaagtgactactactacgatttggtgcttctaccatagatgaagcct
tgtgaccctaacttctggtgatgaagcttccgatggcttcaaacccgatggttttcgtctgtgagcgtagttgacggaaacagcattccactcgtacaga
aggaatttcgtgaccggtggcgtttttgttgactcgcttgactgtgtgagctcacttagcgcaaaaggttgtactgaatgagctcagcactgtgctcagc
ggcgttctcagtctcccaaataggctcgaggtgtttctggcgttgacgatctacgtgctgaagctggcggatcatttgctggcgcataacgtagcgctgc
ataacctcgtaccaaatgcaagcctgatgctcagaagtcggcgatacattcagcacacgcccgctgctgagtttcagggccaaaccgaactctgctccag
accagtagaacacgtcgatcacaacgtccgtgcccagtacccgggagttctcgcgctgatccttacggtaggaaatatatccatcgcggaatacgaagta
gcggcgcttccagttcttgatacgtgccccctgtttgaccaagaaaccttcggcgtagttgttgagcgctaatacctggtcgtcgtcattttctgcgtgt
ttgcggtggtttctcattcggtcttgagtagtaaactgaaggtgtttggtggtgtattgcagtggatgcagttaatttagctatcacggccaaaatgtgg
aagtgaaagtgaatggtggttcaaagttaaaaggcactcgaaatccactgaacagcagcgcacgaaccattacaaagcgattgataagaccaatcattgc
cgtatgattcaggccagtaggagcttcatcgaaatccgacaacaacgaataccgactccagctggggcaaagcccaaaactgttcaactggcagttcaag
atgaagagcgtgaggcaacgcggaattgcgctctcaccactcgtttatcatgcgaaacggaacttgctgggagataaaccttcgttacctgaagtgaagc
gttttgcttccaccgttagttgtatgtttgtactttaaatacattattatgctcaacttgagctattaaaaagcttagatgactgttgttcacgtaggcc
ccagccaacttgcaatcctggttccatctgccgagaagcaggcgagctaggagtttctcatgtggcagagcctgctttgcaggctggaatcatctgtagt
tacccacacgatgaaacattttctttcgcggagctgctcatgtacctttccaacacgacagcagcatatgccgccagcacaacgttgtagaagcacttga
actcgatttcatgacgcagcgatgcaaaaatagcactgtacatgactgcaatatcttataagcaacttcaacttggttccaaatttgtggtacatttttg
gactatttttttttcaaattgaaaaatagtccttgtgacagcgcactcatcatcattccggaagaagacccggaagatctcaaccttccgcagcatgtcc
aagaagcccgagccgagtcccgtgcgcgtgcgactcgccacccacgcaggctcctggtactcgcacgatgagcacgagctggaaggcgagctctcaggtg
acgctttatccatccttgaagagagagttccttcctgtgacggggactatttgcaggttggctggacgccgcggaggatagcgacacgcaggagaagcag
ccaagtatccgcgccattattgggcctcatgcgggcttccggtacgctgtcgcaacgatcaattgactgaaacattgaagctgatgttcgtattgccaga
tactcggggccaacggctgcgttcgcgtatcaccacctgctggacttggaccgcattaagcgcgtcttcatccttggcccatcgcaccacttctacttgc
ggtgtgtggccgtttatagttactatggaattggaggctctggtgctgatttgcttattgtagtggatgcgctgtatcgactgcacacgagtatgagacg
ccgttgggcaacattgctatcgaccacgaagtgaacgagaagcttgtggactcggtgggttggggccatttggaggttgtggatatttgctgatgttttt
ctttccagggaaaattcgcgaccatgtcgatggacgtcgatgaggacgagcacagcattgaaatgcatctccctttcatttataaggtgatgaatggccg
caagttcactgcggtcccgatcttggtcggcaacaccaagagcaaaatggacgaggaatacggaaagtatgatcataacttcgttaggtttcgtagcagt
gcatcgttgttgaacggtagatttgacactacttgctatgattttcagaattttggccccatatctggagaacgatgagaatctgttcgtgatcagctcg
gacttttgtcactggggacctcggtaagagatggaggtgctaatggaatttttgtgtatggactaacgatctcttgctgctttgctcaggttccgctatc
agccgcacgactcgacctatggcgagatccatgaatacatcaaatatttagaccaccaaggcatgggtgtaagtgaagattgcatttccatcggcttatt
gtgttgataccgatggtggtttctgctgtagttcattgagcgcttggacgctgaaggtttcacgagatacctggatgaaacaaacaacacgatttgtggt
cgtcacccgatttcgctgctgttgcacaccattttggcctccaagaagttaaagttcgcgcttaagttcgtcaagtacgctcaaagcagtgcatgtatgc
gccacggtgactcttccgtgagctacgcctcggccatcgtctacagcgagccgtagcacgttccggaccgctcagcgagcttgatttgagtgaaaagatt
gagcatctttcttcatttgcgtacagctaagtattttgcatacatataagcgttcattgctacggtcgtgtgtgaaataacacttctcatcttcattaag
ctgattgtgcattgtctaggttgtttctagttggccttttgcttctccgtagcagccttctctttccggattgtcttgcaactggtcttgtggttcgtcc
agtcctctacctggtggtccttgcagcagtaaaacgccgcctcgcaggcacagcggagcaacgtcgctgcagtttccgccccttcctccttccgagttga
cgagccgcagtatctgcaaccaacctcagccgcactaacctccccgaccatcaccttcttcaagaacatagtctcaaaagtgtgtgccacgttcgtaaga
agcgtgagaataacctgctgtcgcatctgcagcgtgagccacacatcggcttccataagcttgccctgcttgatcaaattcttcttctcctcgatgagat
ctggtgatgcggaaggaagtagcgactgcacattgtgctccgggtcctccagatcaatgaaagccagtgacacgtgcttaaacgtttcacccgagaacgt
aggcatggtaccgctggcacgaagcgataccaagtacagtaaatcgtggcggctgcagtggtccgacttggtagcacgtgcattcatgagacgaagaaga
accttcccgttctcctccagcaacgccttgagcgtcagctcgggagccagcagttgtgtggcctgcggatgcggctctttggggtcgtaggacagcggaa
tgtcgggtgacgcattgcgcagtagagaaacttgacctgcgtagggaagagccaaaaaccagcgcatgaaggacgacgcattgctgcgccaaaagcgggt
caggtactcggcgggagactcctctggcacggaggccgtaggcgctgtagtgtcagctccagccattgcaagtgttggcagcctgctacggtactaggag
ataacccttaccgaaatattccggtacacaataacccttaccgacaatttaccggtactaatcaccggcaaaatttcgataagtaccgtatttgcaaaca
caatgtagccatctaccaactatgtagccatctacaacagaacacagaattcctagccgcataaaagttttaggagacgttgagaggttcatgtgctcga
gatgctcagaacatcgctgccaattttcaactcggtgcggcgcttggtccagtgctgccaattttcagctcggtgaggcacctgctccgtcgctgggaca
cttgtcatctgcagcgcaaacttgccccacctaaagagtctttagcatagtaaagactgggatgtggcgtgatcaatgcagctctacatccatggcttcg
agcaacgcagcttaattccgtaatacatgtagtgctggcactgcctgtcatgcaccgttaccgaaccggtacatgcgcattaaaatcgctcggtgcagac
gagcgcacggcatacacgtacgtgtgcagcaggggcgaaaatccaggcgtttcgacgcatttggacgacaacttgtaccccaaactaaaaacagcacaat
tatagtttgtggcaatctgttgtgcgtatttccagcttgccttctcaaacgccacttgtcttccagtagtacgaacgcatctgcgagccaagtttagcga
cgcctgaagcggagccatcacaaagcggatccagtctccgcttcctcgtcgtctggtgccgtacctacgcacgcgtctgaggtttttcattcgaaagccg
ttcatctcattggttgaaatactctcactgcgaggtttttaaccccaccgtctggttgtgttgcacacacactctggtccagaaggggtaggcgtgccta
tcccttcctgctggctaaccgctcgagtcaaatcgcgtcgcggccactgcgaccgagagctgcagcgtaggttcgatctctctctgcgctccccccgcct
ttgcgagtggcccctcggacatcggcaagtaggcttggaaccccctgtcgtgtcgggaccccaacgcgcgtcaacgtcgtctcctgacgccgaccaggac
gaactgaccacttttttaaaactctttttacagcagccatggaggtcggtgcccccgtgtgggttttcgacaatgaattgtggcacgaagcaattgttac
agcgcccgtggacgcttcctcgggacttgtggagtgtgcagtcgagccagacacgaaagacgaacaccttgtgacttccgagggcgatgaggtcgtccct
gatgcacaggaattccagacaccgcgcagacgtcgtaactcgcgacgcaactcgatgaaacgatcagttaatattcaggcggagctggtactaccacgta
gtcagggagaacactaccatgccgtacaggacctgacgaagctcgtgcatttgcacgaacctgcgattctacaagtgctgagacgacgctttttccatgg
agagatctatacgagcacaggacagatcttggtggccatgaatccgttcagaatattgtcattgtattcggacgacatcaaggaccagtactacgacctc
ggaggaaacgctgaagcggacaaaagcattctagccccgcacgtgtattcagtggcggatcaagcattccgtacgatgttggtgcctcgatcaggcgaca
agaagacggatcaaaccattcttgtgagtggagaaagtggcgctggtaagacagaaaccaccaagctcatcatgaactacttggcttatgtgtcgaccaa
acgtacgcgacgtccaattcgagctagcaattgcgaccagacgaccattcacgaccgagtgttggaatcgaacccgattctggaggcgtttggcaatgca
aggacaacgaggaacaacaactccagccgcttcggtaagttcattaagctcgggtttacttcttcgggcgagatgctgggcgcctccatctccacgtacc
tgttagaacgcgtccgtctcgtgtcgcaaggcaagggagagcgcaactaccatattttctacgaaatgtgtggcggtagttcctcatccgaacgtcagga
gctagcactgcgagatatccgcgagtacgagtatttaaaccagtcagaatgctacgagcgtctggatggagtggacgatgccgaatcctatcaggtgaca
cgacgagctatgtcaagcattgggatgagtcctgacgagcagctcaatgtcatgaagattatctcggccgtactgcatttcggtaatgtttgctttacga
cagctacgcgcaatggtggaaaggatgatgcatccgtggtagatatggacgaatgtggtgacaacatccaggcgatttgttcacttctgggtgtagaaga
agacgtgctgcgcagtacactgtgcacaaaacaaatcaaggctggcgctgagttcattacgactcgccttccggttgcacaggcactttcaacgcgggat
tcagtggtcaagaccctttactccaacctatttaactggcttgtggaccgcatcaatcgaagtatcgagtacaaggaggaagcgggaggcagccagttca
ttggtgttgttgatattttcggctttgagattttcgagcaaaaccgactggagcagctctgtattaactacgccaacgagaaactgcagcagttgtttgg
caggtttgtattccgaatggagcaggatcagtacgttgctgaggagatcccttggaagttcgtggattaccccaacaacgacgtgtgcgtagcgatggtg
gagaagcgacacatgggcatcttttctcttttggatgagcagtgtttgattcctcgcggcaacgacgagaaattggcgaacaagtactatgagtgcctag
caggcaagcacgaaagtttttccgtgtctaaacttcagcgtgccaagggccaatttgtgattcaccactatgccggcgatgtctgctacatgacggatgg
cttttgtgacaagaacaaggaccacatgcacacggaggcggtggatttactgcgtacgtccaaattctcgttcgtgcgtgcgtgtttcgaaaacagtgtc
aactctggcagcgctagcccaaggaacggtcgaacggagtctcgcggcagtgatggccgtcgcagatctggtggcatcatgtcgtccacggtcgtagcac
agttcaagagccaactgagctcgcttttggaagtgctaaatgcaacggagcctcattttattcggtgtattaaaccaaatgatcaggcaagctcgtcgca
gttcgaacggaggcgtcttctggagcagctacgctgcagtggagtgctggaagcagtcaagatttctcgcagtggctaccccgtgcggttctctcacgat
gtatttatcaaaacgtacagttgcatcctgtcgcaggttccaaccgctcaggggcaggcagagaaggaagtagcaagtcgtatgatcgaaaagttgggaa
ccatgctcgaattcgagacggatgcgaaacaccctccgttccaagttggtaagacgaaggtgttctgcattctcgaagctcatcaggctctagaagcagc
tcggtcgaaggccctgtacaagtcggtgattacgttacaacgatactgcctgggttactccgtgcgcagtcggtatcaacgaaagcgtcgatccagtatt
cgtatccaaactatctggcgctcatggtcgtgctggcaccgttaccagcgaattattcgtcggcagcgggcagctgttacacttcagcgtacaactcgtg
gcttcttgaccaggaaacagttgaagcgtcttcatgcagcaacggtaatccagtctttcgtgcgtggatggcttgttcgacgcgagtattccgctaacac
gctgagtttcgaacatgacgtgtcgtacgttggctcccttgatgagcgcagtaccacggcaagttctatctctctttcagagtcgctttcaaaggaccgg
aagaacacaaccatctcgttccagagctccgtctccaccagtgactactcagatactgacggaagcatcagcatccgaagcagttctcgcgcttcaagaa
agaaaatgattgaggagtatgagccgcccaaacatgtccaaaacgagtacgagatcgtgtgggagtgtggactacttggcttgtattttgaaagtgaccc
ggtttccggcatgcctattgtgcgccgtgttcacgagagtttgagcaactgcgcggacatcttcgaagtttctcgcggtgatgttctcctcgctgtaggc
aaggttaaggtgaaaaagggcgatatccgtcgcattctaactttgctgcaagaggttcagaagccggtacgtctgcatttcctccgcaatccgactgagt
cgttccgtcttcgatcaggatcgcttgagcttctgggtgaagaagactatgaggtgctgtggaaggaaggcgtgccgcttggtcttgggttccgcccaga
cccgagcacgggatacccgtgcgttctccagtctcaaggcaaccaacttttgcctggcatgttcaatgtgcgagcaggtgaccacttggtcttcatcaat
gaattctcgacgcagggtgttcgattccagaaagttatcgacatcttggaaagtggacctcgaccggcagtgcttcgcttccgccacactgatctcgtgg
aagacccacaccaccagctggaccagaccaatccactgaacagctcggtgctatcaaacccgcaggacgattctacttcgatggggatgtctcgcatgac
gcgtgcatcccgtgtgagcatgaacccgaagaacgaccattcgctgtactacatcacgtggaaagaggaggacggtcctttgggcatcgttgtcaagcag
gagagcacaagttactacccgcgtgtgataaatgtgaaaagcgagggcgctgttacccgcgagtcgcagaaaaaccgtgtggagattggcgacgttcttc
tgagtatcaacaacaacaacatcagcaagatgggctttggcgctgcgatgaagctgctgcagaagggtccgaagccgctgctgttgatgttccaacgccc
gcgcaactccttgtcaatgacaacaaggagttgtaacctgtagtcctcgtcccgttggtgttaaatattccagttttgagccgcgcggacaccatttcca
ctgctcgtggtggttatatctgcagacgaggatgcagcttggaaggagaggctcactgcgccgagttcttcaccccgtacgacccactcgagactttgta
gtggggcttttccattgcgggcgttcttcagccacgtccgcgctgaaagtattttgaatattcgttttgttataaagagaagttgcgctttcatgttcac
gagtgtgttccttctactagtacatcaattcgtctccatgaggatctcaaagcaaaaacatcaaagtggagattgcaaaagtggaattgaattcacattt
tatctggtaaaaaaattcttgaagaaaagactttgaggatcttgtcttctctactccttcttctcttgacgaaggtgggccaggatggcgtcaatatcgt
ccgagtggtccgtgatgaagtagcgtccctcacgctcaatcatctcgcccttctcgttgaaaaagatgagcgtgggaacagtcttgacgccgaacttctc
gcacagctcgagcttgaggtcgcggcgggcgtagggcagcgcaatccacgacatctcgtcgtagtactcagtgaacttggcctcctccttgtccgaggac
acaaagacgatctcgaagtcctcgtggccagcctccttgatttcgttgtagaccacgtccagcagcggcgtgaacttgcggcacggcgggcagtagtggc
cgctaaagtagagaccgatgaccttctttccggccagcgcctgagacgtgggcaccacctcaccgctcttgagcagcagttcgttctgcagaagggcctc
cattgctctgtatgtgtgcgctcttggacgaggatgtaggaatgaggaggcacgttttgatcaaggaagagctacgattttggcgggactctcgatgatt
ggacaaatcgcgtgactggagcaacgaagaggcttgattggctgagaaaaatccaagatgacgcgatatggctacattcgtctacggaatcaggacagaa
ctcagtgataaccatccatgttttagcttgcaagctttcgctactcctgctgcaagttatcttcccttcctaaacgccactaaaaactcgttaaaggtgg
agctgcaactgttgcaactcgagctcttctccgctcccctctctccatctctctttgccttgttcatggttccattgccatgcaggctgcacgtactact
tagcagtagaaaaagccaccaaacgagcgcccgaaaaagcagctcgagccgtaaattgagcggccgaaagtgttccagtagccaagggggtagcgccaac
cgtagcggaatcctccagcccaagggtacgtgtagcgccagcggtatgtgattcctccagtcgggatgaaaccacctccacctccaatgaattgttccaa
ttgctccttgttagtaggcacaggctcgcgatctccaagaagtgtcacaccgggtggggtctgctccgttgaggggcgctcttcaactggggctgcaggg
ttttcatcggcgtgagcacagctcagcatagcaaccaggaccaccaacagaaggacagtgatacgcttgatcatgatggcggaaatgactcggggtttca
ggctcttggtcaggtgttcactaaagtgcaaaaagccgaatgacaaccacaccaggcaggctttgctgctcctcagcagggagaaagatctgcgctcatg
ttcagctcgttgcgtgcaatacctgggacttgcaacgaaagctcgggctggcagaaagaaatctcactcgtcccatagcacgacacttggtatgtacttc
gtgcgtttccaggataattgtccggaaatccaatgacaggttgtgatcttggtcaattacatgtacagcaatgaaataatttactttcgcaggggtgatc
ttggctggtgctgagtgcagacttcaaatctggagttcgattctccctcgcttgcgccttttcctaaaacatctaaactttgtatcgaaatgaaaatgga
aacatgccaacctttatgatctactcatgcatctacagttgcaattgaagcacttgactcgagccgaaggtcttcgcgtttcttcaatgatgagagttcg
tgtaatcactcgatgcatccaagccaccgccgaagccgttcccttggcgagctttcattggctaaccaccacgtcacataggccgcaacacggcgtccac
cgactcgcgccgacgtgcatcaaacggacggcggcgcagttttcaacaggcccgcgagcgactagcaagacttctcaccgccccctccctaactctgcca
aaatgccgcgccagctccagcccgagcagctgcttcagcccgtgccgtccgacatcgccatcagcgatgccatcgcgccgttggccatcacggaaatcgc
ccaggccgccggaatcgtaagatacttccggtcgtaacggagacaattgttgatatttaaccaatgtgtaccgttattgctatagctccctgaggaggtg
gtgccgtacggatcgacgaaggccaagatctccctggacgttcgtgaacgtctgaaagaccagcccaatggcaactacgttgtggtaacgggaatcaccc
ccacgccactgggcgaaggcaagagcaccactaccatcgggtaagtgtgaagatcgggggaaggtggtgatgtagagctaatgaaaagatgatttgatca
gactgtgccaggcgctgggtgcccacctcgacaagaaggcgttcgcttgcatccgccaaccctctcaaggacccacatttggtgtcaagggcggtgctgc
tggtggaggctatgcgcaggttattcccatggatgagttcaatctgtacgtgggatttgtgatgcgtttggaggttctgtgctgacactttttgtgtgta
ttattgcagccatctgacaggagatatccacgctatcactgctgccaacaacttggtgagtagtttatgtattggttggttgggttgtgactacccattg
acttaaacactcttgtgctgttcgtagttggctgctgccattgacactcgcatgttccacgagaacgcgcagtcggacaaggcattgttccgccgtctgt
gcccgacggccaaggacggatcccgcaagttctctcctgtcatgctcaagcgactgcagaagctgggcatcaccaaactgtcgcccaacgatctcacaga
cgaagagattcacaagttcgcgcgcctagacattgacccggacacgatcacgtggcagcgggtgctcgacacgtgcgaccgattccttcgtcaggtggtc
gtgggtgctggccccgccgaaaagggacaaacccgcaagactggcttcgacattacagtggcaagcgaaatcatggccatcttggcgctgacaacgagcc
tggccgacatgcgcgagcgtctaggacgcattgtcatcggcatgagccgcgatggtgagcctgtgactgctgacgacctgggagttggcggtgctttggc
tgtgctcatgaaggatgcgatcctacctactctcatgcagacagtagaaggaactcctgtcttcgtgcacgctggtccgtttgctaacattgcgcacgga
aattcgtctatcattgccgaccagattgctctcaagctcgcgggtgaagatggtttcgtggtcaccgagtgtggctttggagctgacattggcatggaga
agttcttcaacatcaagtgccgtactagcggccttaccccccagtgcgtggttcttgtttccacaatccgtgcgctaaagatgcacggtggcggccccaa
tgtggtcgctggtaagccagtaagtattttgttctccattatctatcgtcgtttatttacaactaattgcttcttttgccgtgtagcttgatcccgtgta
cgtcgaggagaatcttgaaatgctggagcgtggatgcgccaacatgcagcaccacattcgcaacgctctgaagttcggtgtcgcggttgtcgttgctgtc
aacgtctttgcacaggacactcctcgggaggtggagcttgtgaagcagaaggcaatggaggcgggtgccactgctgccgtagagagtaatcactgggccg
aaggtggcaagggagccaaggacctaggtcgcgctgtcattacttcttgtgataagatgcgtgcgcagggcagcccgttcaagttcctgtatccgctcga
gttcagcattgctgaaaagttcgaagttatctgcagtacgttctcctttttcccatttctgaagtgttgagaacaccactaacgtggcaatttctttgtg
atgaacagaggagatttacggtgctgacggtgccgagttcagtgaggaagctaagaagaaattggcgatttactcgaagcgtggatacggcaatctcccc
gtgtgctgtgcgaaaacccacttgagtctgagcacggatccgaccgcaaagggtgtgccaacgggcttctcagtcacagtgcgtgacattcgcgcgtctg
taggcgcaggtttcgtttacctgctctgtggagacatgatgacggttcctggtcttccgacgcgcccagggttctacgatgtcgatattgacactgaaac
gggcaaggtgattggcctgttctaagcacttccagtcatagcgaaccccattcgacggcaagcaaagggcggcatgttagttcatgcccccctctccttc
ccgtccaccgcgcctgctacggtactgcagctagagacaaataaacccgtttagtcacccgtttttcatgataatgcgtgtatattgtcttggatcctgg
caggtctaactgctctcagctgaagcagccggcgtctcggtcggcgtctcggttggcgcctctggaggcttcccttcggacctgttgttgaggaaagttt
gccaatggtagaactgttggccgtgtacgagcgtcatgaagtcctcgcgcgcaatcatctggcggaatctctcatcatccagcatatccaagaaggccaa
gcaatgtgggtacacgatgtacttggcgtactgcggttgtttccagtatttgagatattgcaggtagttcatgaaggccgggttttcgaagtacctattg
atggcaaggactggtagcaaaggaggcggttaaagcgcggaacaagaggctgggggaggatatacgcacttacagttgaggtaggcaggactagcgaggc
actggatgaactccagctccatttggaagcgaatatcgttagacggcacctccaccttagcgctcattgtgaaaaagtgaaagtgaatttcgcaaaaggt
tttgaagttacggacaacattcgagcaacgttcgcgcaacaattaaaccaaattgtgacgttttgaattcgattaggatgaatgttgtggatgaactata
tatccactgtaaaactttagatgacgaggccggatcggaagctggagcaatgagatgctatggaatccgtgttagccgacgtcgagacgattcgttctgc
ttggaacagagcgtgcgcttcgtcatcgtcgaacatttcgctagaccaatcggcttcaaacgccaaattggacaacgacgccttgagatcttcttcacct
ccggtctcttcgcttctggtgtcgtcagagtggctatgagtcatcgcaaaattggggtgacggtgcttcagttccaacggcacgatggacgtgaagctcg
tgggggacagacagctattttcaaactccatgaacatcaagtcgtcgtcatccgtcgccatcgggtcaaccgaaagcgaggcaacacctgctgccatgtg
actttccggcgggggattcctcgtcatggagctaaactcgacctcagacagtacaaaactggacgagtcagcgaattggctgggcaggttactgagagag
ctgatggtgtcaatacagcgcatcatgcgtagcgtgagcgggatcgttgtgagatgtatccacagctgtgaacttgaactgtttgacagcctcaccacca
ttctcatgtgctgagacggggaaagcatgcctccatcgccgcgctgttgctgcgcttgaagaaagtcctcaagcttctctgcgtctccgatcgtcaggta
ctggagcaggctagcaccgtacaagtctgccgcgtcatcggccccgaactcggaggcgcaagtgtctgccacgaaaatgaacgcacccgacgggaggcag
taggcgatacgtttgccggtcggaacctggttaatctccaatagtgtgacggtgcccagccccatgatggctgcagtcaaacggcgatgtcttggatctg
tggtgctacgaagcactttcaaagtgacacagcagtacggtaatgatcgtttcggggtagacttcgggtgtgtaacaggaaagtgaccgagtgagtggat
ctatcggtcggtcgaacttataagaaccggcagagagaactgactgacagacagcccaggctaatgatagattctggacgcacggacgtactggcgtgca
gggcctggcaccctaacagcagatcgcacaatgatgcagttggttccgcgtgggttgggcgatgagagcgaggaggacgatcgggctgcgggttgcttgc
tttctggctgttggagggttggtttggtggttggtgggggtcggcctcacttgcacccgttacttgctgtctgtttggtcaagctgccgatgcaacaatg
gcgagcggttcaagttgatggaacgagcatggatcctgttgtaagcggtgccaatccgacgacgcgaaagacgaaccagattttcatggcgccgaaaacc
cgtaattagtgatctcagcgagtctggagagttatttattttacatgaagctttttacctctgcacaacttgagactgctaacggacttggcagggctgg
aaaagattgcaggcattgcaggtcgctcgttgaacttgcacttcaactttaccctaaccaggactgacgtgcttttggtacgatgtacccttcaactcgc
cagttattggttgaaaagacgtgaccagccaaactgtcgaagcggtgcaacgtcga