Description :
From Genome Similarity Track
Location :
Scaffold_379:74158- 77102
Transcript NameFunction/comments
Aphin_H310_07007PREDICTED: insulin-degrading enzyme
Aphin_H310_07008Hypothetical protein

Sequence
2944 bases(100 bases per row)
CACGGCGCTGCATGTGTCACCGTCGAAGTCGGCAGCTTTGCAGATCCGCCTCATCTACAAGGCTTGGCCCACTATGTGGAGCACATGCTGTTTTTGGGTA
CGCTACCGCTCACGCATCCATGCTGTGCATCGTGCTCACGTTGGAATTTCAGGCAGCACAAAGTACCCCGATGAAAACGAGTTTGAGGCGTACTTGAGCA
CGCATGGCGGGTACACCAACGCCACAACAGACTGCGAATCGACGTCGTTCGTGTTTGAAGTAAATGCAGCGGGGTTCGAGCATGCGCTCGACATGTTTGC
CAACTTTTTTGTCGCCCCGCTTCTCCATGTCAACGCGATGGAGCGGGAGCTGTGTGCCATCGCCTCGGAGTTTCAGCTGGCATCGCAGAACGATCACGTT
CGCATGCAGGTACGGCAAACGGAACCCACTACGTGGTACCAACACGGAGTGTTAGCAAGTGCTATGTTGGCTGTCACCACGTAGCCACCCGTACCACAAC
TTCAGCTGGGGAAATCAACTGAGCCTTGGCCCACAACCTGGCAAGACGAGCATGGCCGACACGAACACAGCCCTTCGCGAGTTCTTTGAGAAGTACTACA
CGGCCAACGCGATGAAACTTGTGGTGTGTTCGACGCAAGACCTCGATACCTTGGAAGCGTGGGCAGCGAACTCGTTTGGTGCTGTGCGGACGGGACGGGC
TACTCCATCCTACCGACAAGACGGATCGCCCTTCCATGCGATTCAGTCCCAGCTCATCAAGATGATTCCGCTCCGAGATATGCATGCCATGCACATTTAC
TTTGCCTTGCCGCCGCTGCTGGGCCTTCACCGCCAGAAGCCAGCAGAGTACATCCGGTACATCGTCAGCAACGAGTGCAACGGGTCGCTCATCTCGACGG
TGCATGCCGGACCCAGTTGAAAACTCCTCATCCGTCTCGCTCGTAGTTGACAAAGGTCGGGTGGGCGACAGCGATTGTCGCGGGGGTGTCCGACACCGAC
GGCTACGAGTCTGGGTCGTACGGTTCCCAGTTCGAAGTTGAGCTCACGCTGAGCGACCAAGGGATTGAGCACTGGGACGAGATTGTCGAGCACGTGTTTG
CGTGTGTAAACTTGCTCAAGCAGTGCCCCGACCTACCCGCGTGGGTCTTTGACGAGTTGAAGGCGTCGTCGGAGCTAGCGTTCTTGTACAACGAACCAGT
CGATCCCCTCGTGGCGTGCAAAGAGTTGTCCCGGCTAATGCAATCCCGAAACAGCGTCCCTCTCGACGACCTCCTCCGAACAAGTTTGTTTCAAGGCCCG
TTCCAACCGGATCTGGTGCGGCTGCTGCTGCCGGCGTTTTCGGTCAAGAGTCTTCGGGTGGTTCTCCTGTCGAGCTCGTTCGAGGATGACAGAGACGTCA
TGTGGACAAAGGTGTGTGGCTGTGGTGCGACCAGCATGCGTCACGAGCTGGGTGTAGGAGCCATGGTTTGGCACGCGCTATACTTGCGAAACCATCGACC
CGCGCCTGGAAGACACGTGGAGTCAGTCGAATCCCATCCATGCGCAATGGCCATGGCGAAATCCATACATCCCGACGGATTTCCGATTGATGATGGCTCC
ATCGACCACGGCAATGGTGGTGCCGTATCGAGTTCGCGGCCACGACGACTTGTGGGTCCTGCCTGACTTGACATGTGGTAGTCCCCGCGTGAATGCGTGC
ATCCATGTCGCGCTTCCGACGGTACACCGATCGGTGGACGCTCTCGCCTGTGCCCTGATGTACTGCGAAGTGGTCAATCACGCCCTCCGGGAGCACCGAT
ACCTCGCCGAGTGCGCTGAAATGGTCTTTGACTTGACTGTGCACGATTTCGACTTGGAAGTGTTGTGTCGTGGGTACAGCCAGCACATCGGGACTCTCTT
GTCGATGATCTTTCAAACCCTCGCGGCTGGCACCGTCGACGTGACTCGATTTGATACGCTTCGTCGTGTATTTGTGCAAAACCTGCACAACAAAGATTTG
GAGCCAAGCGAGAAGTCCCGGCACTTGCGCTTGCTTGTGCTCGACAGCACTGCAGTCGAGACACACGGCATTTGCGCGGCAGTCGAAGCCATGTCTGCCA
GCACGCTCGCATCGTTCGTCAAGTCAGACATGTTTACCAACGCGCGCATCACAGGATTCTTCCATGGCAATGTCGACGACACGTGCGCTGAAGCGATGTG
GGCACTGGTGAAGCAGCACGTTGCAACCGCCACGGCGCGAAGTTCCGACGCGCCAAGCATCCACACTCTGGACAAAAAGCCCCACGCACTGGTCCTTCCT
ACGTCACCGTTGGGGCGAGGTATTCTCGTACGGCAGCCCAGCGAACACGTCGAGGAAGTCAACTCGTTCGTCGAAATCTACTACCAACTCGGTGTGCGGG
ACATCGCTTCGAACGCATACGCCAACCTGATCCAACACATCATGAACGAGCCCTTGTACTCTACCCTGCGGAGTCGCGATCAAATGGGATATGATGTCGG
GTGCTGCGTGCGCAACACGCACGGCGTGCTTGGGTTCAGTATCTCGGTGCAATCGTCGGCATATTCGGCCAGCGAGATAGCTCTGCGCTTGGACAAGTTC
GTCCATGTGGACTTTCCATACGTGTTAGAGAGCCTGGACGACGACACGTTTGAAGCACACGTCGCGGCGCGGAAAGCAGCGTGGCATCATGCGCACCGTG
CCAATCTCGACACGGCAACGTCCTTGTACTGGGACGAGATCATCTCGCAACGATTCGAATTCAACTCAAGGGACTTGTTTCTGGACGTGTTGTCGACCGT
CACCAAGGCCGACTGCATTGCACGATACCACGAATGGTTTGTCGTCGCAGCGACGAGGAAAAAGATGCGCGTGCACGTCGTGGGGCAGAACCACCGTGCC
ACCCACATACCATTCGAGTCGATTGTCGAGGAAGACGTGGCTCC