Description :
From Genome Similarity Track
Location :
Scaffold_281:7415- 9426
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_281-abinit-gene-0.43Protein pelota
Pytap_DAOMBR444maker-pag1_scaffold_281-snap-gene-0.13Trafficking protein particle complex subunit 2

Sequence
2011 bases(100 bases per row)
CACAGCCCAGGATGAAGCTgCTGAAGAAGCAGATCAGTGAGAAGGATAGCGCCGGCTCCGTGGTGCTGCGTGCGGAGGAGCCGGAAGACATGTGGCACGT
GTACAACCTGATCCACGTGCATGACTCGGTCAAGACCACGACGATCCGCAAGGTCAGAGAGAGaTAAAAAGGCTCAGAAGACGAAGCGTGGCTGACGATG
TGTGGTGCAGGTCGTGAAAGAAGGCGTGACGGGATCTACAAGTAGCCAGCGCGTGCGCCTGACGCTGCAGATTGATGTGCGTATCGTGTTGGTCTGTACA
AGTGTGATGGGTgCGGGGGgTTGATTCAGTTTGGACTTGAGCAGGTGGAGCAGATTAACTTCGATCCAGCTCAGTGCGTGCTGCGTATTAAGGGCAAAAA
CACGCTGGAGAACCAGCACGTCCGCGTACGTGGGCGCCATACTACCATGCCGAGTCCAGTGTAGCGTACTCACAGAGCTGTGTAGATGGGAGCGTACCAC
ACGCTGGATCTGGAGATGAACCGCGACTTCACGCTGACGAAAAACTGCTGGGATGTCATGTCCATTGAGCGCATTGAAACCGCGTGCGATATCACGAAGC
GGGCTGAGCTCGCGGCCGTGGTAATGCAGACGGGCCTGGCACATTTGTGCCTGATCAAGGGTCATATGACTGTCATCAAAGCCAAGATCGAGACGAGCAT
TCCAAAGAAaCGCACGGGCAGCTCAAACCACGCCAAGGGACTCGAGAAATTCTACGAGAACATTGTGCGCTCCATCAAGCAGCACATTGACTTCAAGCTC
GTCAAGTGTGTGCTCCTGGCGAGCCCAGGGTTTGTAAAGGACGACTTTTTCAAGTTCATGATCGAGCAGGCGATTCGTCAGGACGACAAGCTGGTCCTCG
AGAACAAGCCCAAGTTCATGCTGTGCCACTCGTCGTCAGGCCACAAACACGCGCTGGATGAAGTCCTGAATGATCCGGCAATCCAGTCCCAGGTTGCTGA
TACAAAGGCAGTGGAAGATGTCAAGGCATTGGAGACGTTTTTCCATATGCTGCACACGGATCAGGATCGCGCCTACTACGGTTTTAAACATGTATCCCAA
GCGAATGAGCACTTGGCTATCGAGACGCTGCTCATCACGGACGAGCTCTTCCGTAGCCAGGATATCGCAACGCGACGCAAGTACGTAGACCTCGTTGAGA
GCGTGCGCGACAATGGTGGTATCGTCCGCTTGTTCAGCAGTCTGCACGTGTCTGGCGAGAAACTGGGGCAGATTAGTGGTATCGCAGCGATTTTGCGCTT
CCCGATGCCTGAAATTGACCAGGAAGAAGAGGATTCGGACGACGATGATGATGACGAGGTGACGCACGACAATGGCGTCGGCGACCTGTCGATGGAGTCG
CTTTCCATGTAAATACAAGAGAAGTCTTGTTCAACGATTCTTACGGGTTGCTATTTTGCTGCATGACTAGGTTGTATACCTTCTTCTCGAACGCTGGTGA
CGTGATGCGCTCTCcGATGGgCGCAAaCGGgTtGgACATGgCGTtGACGTACAGTTtGTGCAaTtCGgCGAaGAaCTACAAaCACcACAGTCAGCcGCcA
GCGTACAGAGCGACcGCATGGgCACTGCTTCACGCACCGTTCGCAGCTCTGAGTCGCGCACGGGACTGTCCTGCATGATCGCGATCAATTTGACAGACGT
GTTGGTCACGTACGCATACACGCGGTAGTCCTCAATCGGCCCGAGGAAGCCAATATACATGTCGTCCTTGGCCGTCGTCAAGCTCGCTGCGCGCAGCTTC
TCCTCGACGATATCGAGCGCCACGTGGGCGATGTAGTGGAACCCGAGGTCCTCTTCCTCCTCGAATGTTCGGATGTATAgCGGGCTGTTCTGCTCACACA
GACCGCAACACATAGCACTGTCAGTCTACCACATACGACACCCACAGGAGAGCCAAGTAGTCAGTAGCAACGACATACAGAGGCGCCGACGACGGCGACG
CATGCGATCAT