Description :
From Genome Similarity Track
Location :
Scaffold_303:7411- 8896
Sequence
1485 bases(100 bases per row)
AACCTGATCTTGGAGTCCTTTGGGAACGCCAAGACGTCACGGAATGACAACTCGAGTCGCTTCGGCAAGTACATCCAGATCCTTTACAACGGCGATGGGC
GCATGGTCGGCGTGTCGATCCGCCACTTCCTCCTCGAGAAGACGCGGCTCGTGATGCCGCAGGCGAACGAGCGCAATTACCACATCTTCTACCAGCTGCT
CGCGGGCCTTGCGAGTCTTGGCGGTGCCGAGGAAAGCAGACTTAAGCTGCAAGGTGATGTGTGGAATTACACGTACTTGACGCACGGTGACTGCGTCGAA
GTGGACGGCGTGGATGATGCAGTGGAGTTCGACCAGCTGCGCAACTGCCTAAGCCAGCTCGGCATGGACAAGGCTGGCTTCCAGATGCCAATGTTCGAAA
TCCTCGCGGCTGTGCTCCATCTAGGCAACGTCCAGTTCCAGTCTGTCAAGGATGAGGGCGGTGGCGAAGAGAAGACTGTTGCGTTCTTCCCTGAGAGCGA
GCGGGGCGTGGACTTGGCTCATGTGTCGGCACTGCTGGGCGTGGAACCACAGGAGTTCGCCAAGAAAATGGTCACACAGACGACGATCACGGGGCGTGGG
AGCATCTTGGAGATCAAGTTGTCGGCGGACCAAGCGAAGAACGCGATGGATGCGTTCTGCAAACACATCTACGGCGAGCTGTTTCACCACCTCATCGCAC
GCATCAACGCCTGTGCGAAGGAGCACACGGAGATCGCACAAGAGAAGCCAAAGAGCTCATTCAAGAGTGGAGCAGCGTCACCGGCTGCGTTTATCGGGAT
CTTGGACATTTTCGGCTTTGAAGTGATGAAGAAGAACAGTCTGGAACAGCTGTGCATCAACTTTACAAATGAGACGCTCCAGCAGCAGTTTAACAAGCAC
GTGTTCGTCCTCGAGCAAGAGCGGTACGCAAGCGAGGGCATTGCCTTCTCGATTGTCGAGTTCAAGGACAACCAGCAGTGTCTTGACTTGATCCAGAAGC
CGCCAACGGGATTGCTGCCACTGCTCGAAGAGCAAATGCTGCTGAAGCGCAAGACGACCGACAAGCAGCTGCTTACGATCTACCACGGCCAGCATCTTGA
CAAGCACCCGAGCTACACCAAGCCGCGCTTCGAGTGCGACGAGTTTGTGATCCGACACTATGCGGGCGAGGTTGTGTACGACATCCATGACTTCATCGCG
AAGAACACGGACAATCTGCACGACGACCTTTTGGATCTGCTTAAGCGCAGCTCACAGTCGCTTGTCCAAGCGATTTATGGTGGCACTGCGGACAGCAAGG
TTCCCCAGAAGCGAGGCGGAACCGCCCTAGTGTCAGGATCGGCGGCTGGACATAACAAAGGCAAGCAAGGAGCTGCGCTGACGGGCACATCGACGGTGAC
GAGTCGGTTCCGATTGCAGCTCTCGGAGTTGATGGAGGTGCTCTGGAATACGACGCCAAACTACATCAAGTGCATCAAGCCCAAC