Description :
From Genome Similarity Track
Location :
contig_31:74108- 76558
Transcript NameFunction/comments
g6048.t1hypothetical protein

Sequence
2450 bases(100 bases per row)
TCCAGCCAGCATCATTTGCCAAGTCGACAGAAGCTCCACTTTCCAGCAGAAATCTCACCACAGCGACGTGTCCGTATTGAGAGACATACTTCAGTGGGGA
GTTGCCGTCGTCGTCTTCTGTATCAACTGGAACACCCTGTTTTAAAAGATCCTGAACAATCTCGAGCTCTCCCTCCTCACACGCTGTGAACAGCTCTCTG
CTCTTGTCCGAGCTCTCAACTTCGAGGTGCATCGTCAATTCTTCGTCTTGTATTTCCAGTGCAGCACAATTCTTCACATCTTGGTCTTGAACCGCACCTT
CCGCATCAGTTCTGGTTCGTGCCATGACTTGTGGCATCTCCAAGCACACTTTCACCAAATCTCTCCCGCTCGACGTCTCCCGCGCAAATTGAAGAATGGC
AGCATAGTGGCCAGAGCGCGTGCATGAGCCAGCATATTGTACCCACTGTTGGCAGGTGCGTGTTTAATTAACGAGACTAGCACATATTCGTATTTGGACA
TCTTTTCCGAGAGTACTTTCACGACTTCCTTGTGTCTGTTCTACACGGCAACCACGAGAGCAGTTAGCCCAGCACTATTAACTGGATGCATCGAGGCACC
CTTTTCAGCCAGGACCTTCGCCAACGCAGCATTACCACTTTTGGCTGCTTCGATGAGAGGGGTATCGCCGACTTTGTCTGCGAGATCGAAAGACGCGCCT
TACGAAGTAAGCAACTTGACAACTGCGAAGCGATCGGCATGGTGTTCAATCCAAACCACGTGTTTCATATCCACGAGTCGCTACCAGTACTGCACGTGAC
GGAATTGTTGCCTTGCTGGGTTATGCAAGTCCAAGTTCTGTATATTTGTGTTCTACATACTGAAACTACACTCAAAGTCCTGGCATCACAACTTGCTGCT
TACGTTGCGTTTTTCCTGTCAACTTTGGTTGCCCCCACCATCATCCCAGACCTTTCGAGCAAGTTCCTCACGCCGATATCTTCCAGAATCTTGACAACGG
CACCAATTCCGATGCGCTGCGTAGGATCACGACGACACATTCGCTCAATGAGATCCCATTCCTCAGTTTGGAATTTCTCTGAACGTGTGGGTAGTTCTCC
CTTTTCCGCTTTGTGAGTCACAGTTTTGTTATCAAGCATCCCCCACGGATGCTCCCCGGTCACAGCCTCGATGATGCACATTCCGAACGCATAAATGTCC
GAGGCGTAGGTAGGAGGTTTACCTTTCAAGCACTCGGGTGCCATCCATTGCACTGCAGCTGTCATCAGTGTCTTATCCTCGGAAGTGTAGGCCAGAATGC
TCAGCCCAAAATCGGCAATCTTTGTCGCTCCCCCTTCACAAACGAGAATATTATTCCCTTTCAAGTCTCCATGTACGATGTTGTGCTCGTGAAGGTGCTG
AAGTCCTAGCGCTGCTTGCAGTAAACGAAACCAGGTCTCGTGGCGTCTGCTCTTCAAATACGTGGGGAGGATACCCCGCGTTGCACGCTCGCAGACGAAA
AAAGGCTGGCCCTCGTAGCATGCAGCGTACAGCTTGATCAAGTTGGAATGATTCAGCGTGAACCACAGATCTGCTTCTTGTCGGAACTTTGCCCGTTTCT
CCGGAGTGATGACGGGGGAAATATCCAGTTTAACCACAACATCCGTTCCAAACCATTTGCCGTGGTACACAGTTCCAAATCCGCCATCGCTAATATGCTT
TCCGAGCTCAATCTGGTAGCCGGGTACAAACCATTTGGGAAGTGCTTCTCCAACTTTCGCACCCTGCAGTGTTGGTATCTTTTTGGCAGCCAAGACAACC
TTTATCTTTTCCACATCTTCAGGTGAATAAGCTCCAGAACGGCTGTGGGCCTCGAAGCGCATAGTAGTCAAAGCTTGAGTCAACTGGTTGCTGGGAATCT
CATCGAGAAACTGTTCGGGGTTATTCAAGCACGACTGAAACAGTGTAAATTGCTCCTTCCGAGCTTGTTGCCACGTAGGCTGCCACTGGTGCCAGGCGTT
TCTTTTATTGAGGAGAGGTGAACTTCGTACGAGATGATCGATTCTGTAGTGAAAACGGGAGTTCATGTTGCCTGTCGTCTTTGAAATCTTTAAATTGGAG
CGAGAACAGTCGAGACAGTCTTTATCAGCCGTTTTGCGAAAAGCCCGTGCCAGTCCACAAAACTCATCAAGTAACCCGGACGGTACCGGCTCGGATAAAT
TCAAGAGTTGCGTGTACACGTCATGGAGACGATTGCACACGCGTTCATTCTTCTCCGCGTCTAAACCGGCTGCTTGTCTGCATTTGTTCTTGATCCCACG
CATTACTTCGGCTAGAGTTTCACCGCCAACAGTACAATCTTTCTCGAAGTACTTGCTTACATCCTCAACAGCTGAAGTTTGTCTCTCTCCGTTTTCATCT
GGTATCAGTGATATGAAACCCGCGTCAGCCAGCTTAGTTCTGGATGCCGG