Description :
From Genome Similarity Track
Location :
Scaffold_2375:741- 3028
Sequence
2287 bases(100 bases per row)
GTGGACATCTTCAGACGAATTTATCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGA
CCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTCACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGAC
ACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTATGGGCAGGC
TCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTAACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCA
GAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGGGGGCGCGTCGTGCGCCTCCGCGAGGATATCGAGCTTCAGATCCTCG
TCGTTGGGTACGACCACCCGTGGAGGTTCACTGGTCTCCACTCGGTAATAGAGGAGGCCATCCTTCAACTAATATCGGTGGAGCCGTGAGAGCTGTCGCG
ACGAGAGCCAGTCGGACTTCGCGCTCGTTCCTGCCATGAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCTCGATACGCCATGCGTATCCGATCATA
TAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTGCTCGACG
CGGAAGTTGTACTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGACTTAGTCGTCGTCCTCAAGGATGCGTGGTCTGTGTAGA
TCACGAAGGGTCTCGAGCCCAGAAGGTGAACACGAAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCGTGGACAGGGTAGTTCCTCTCGGC
GGCTTTGAGCTGCCTGGACTGGAACGAGATAACTCGTTCATGTCCAGCCGTGTCGTCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAG
ACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCT
AGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCA
CTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCACGCTGCTGCTAAGGGTCCTGGAACCTGGTTCGGGGTCAGCCCCGAAGCCCACGTTGTTGAAGAC
ACAAACGCAAAACTTTAAATCTCTGGTAAGCGCAAAAGCACTTGTTCCAAGTTTGGGCTAAAGACTGTTTCGCCTCGCCATCCCGTTCCCCAAAACTCCC
ACGGAGGTGTTCCTCGAATGTCCCCTCCCCTGTTCGGTTCTGCCTCCCTCGGCACGCCTAAGGGACCATATGTCGTCGAAGTACGTCTGTACGAAGGTAC
GCAAAGGGCGGAACAATTGCGTCACCAGGCGATGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGA
GTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTACTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGT
TGTTCAACAACACATCTTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGG
CTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCAC
TGTTCGCGCGGGATAGGTCATTGCCTCGTGACACTATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCG
GTGGGTGTTTATTCACCACGTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTG
CTTGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTACTCCTGAGTGGTCTCAGGTCTCATGAGTACCAT