Description :
From Genome Similarity Track
Location :
Scaffold_1101:741- 2223
Transcript NameFunction/comments
Phyag_g9491hypothetical protein PHYSODRAFT_516060

Sequence
1482 bases(100 bases per row)
ATGACTCGTAGCGCTTTCTTCACCACGGAGGATGCCAAAATCGCCTTCAatctcttctgctgcgtctacGGCGTCGGAACGCTCGGCATGCCAGGCAATT
TTTCCCGTGCTGGCCCGGCGATCGCCATTGTGGCGCTGATCTTCATGGCTTTCGCGAACGTATACGCCTCCGTGGAGATATCCAAAGTAATGCTACTTGC
ACCGAGCTCCGTGCGCACGTACGGTGACATCGGCGAATGGTGTATGGGCAAGGGTGGTCGCTACTTAGTGGTCGTCTCGCAGATGGGCGTGTGTCTGCTG
GTGCCCTGCGTTTTTCTCGTGTTGGGCGGCTCGCTACTCGATGGTCTCTTCTCGAACGCGTTCGACCAGAAGGTCTGGATCGTGTTGATGGCGCTTATGG
TGCTGCCGGTTTGCCTCATTCCAACACTGAAGGAAGGAGCGGGCGCCGCTTTCGCCGGTTGCGCAGGAACCATTATGGCCGATTGCATCGGTGTTACAGT
CGTCACACACGGAATGCGTGGCCACCCGAGTGTCCCGGGGCCTCAGATCTCCTTCTCGCAAGTTGCCAGTGCTTTCGGAAACCTGTCGCTAGCTTACGGA
GCTGGTATTGTTATCCcggatctgcagcgtcagcacagTGACCCGACTCGTATGCCTCGAGTAGTAGTCGTCACCTTGACCGTCGTCTCGGTGCTCTTCC
TGGCACTCGCAAGCAGCGGATACTCGTCCATGGGGTGCCAGATATCGGGCAACCTACTCTTCACCATATACCCAAATGCAGCTACGGGATTGACTTCGCT
TGGTTTCGCATCGAATTGGGGTGCTGTTGTCCTGGCATATTTCTTCATGCAGTTGCACGTCACCATTGCTTTTGCCGTTGTAGTCTCACCAGCATTCTAC
ATCGCGGAGAGGCTTGTGCTCGGCATGCACCAGCATAACTCTCAACAGCACCTACCCAGAGATGATGTGGAAGCAGCTATCAGCTACGACCCAACCGGAA
CTCCTATCTTGAAGGGGCAGCATAGCTCGAAGCGGTCGATGGGGTCTATCGTCTCGATGGCAGATATCGAGAGGaacacggacgacgaggaagcgGAGGC
GGCTGAGTACCGCGGCGCCAATTCAATCAAGtatgtgctgctgcgcattgCCATTGTTGCATTGCAAGTCCTCGCCTCGGTGTTGCTAAAGGACCACTTC
GCGGACTTGAGCGATTTCGTGGGCTCGTCAGCCATCACTATGAGCTGCATTATTCTACCGATCGTGTTCTActtgaagcgctgctgggAACGAGTGCCCA
TGTACGAGAAGGTGCCGGCAttgctcgtcgtcatccttTGCTTTGTGCTGGGCTGCTACGTGACGTATTTGTCCGGCAAGGAGCTCTTTGCGCCTTCAGA
AAGCGACGTCAACTTCCCGTTCTGCGCACCAGAATACCAAGACCATGTCTACTTCAACTACACAGCCGAACACGAGGCATAA